ID: 928511685

View in Genome Browser
Species Human (GRCh38)
Location 2:32009816-32009838
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928511685_928511695 8 Left 928511685 2:32009816-32009838 CCGGCCGCACGCTTCCTGCAAGC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 928511695 2:32009847-32009869 GCGACAAGTCGGCTGGGGTCCGG 0: 1
1: 0
2: 0
3: 5
4: 51
928511685_928511693 2 Left 928511685 2:32009816-32009838 CCGGCCGCACGCTTCCTGCAAGC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 928511693 2:32009841-32009863 GAGGCGGCGACAAGTCGGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 33
928511685_928511696 9 Left 928511685 2:32009816-32009838 CCGGCCGCACGCTTCCTGCAAGC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 928511696 2:32009848-32009870 CGACAAGTCGGCTGGGGTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 65
928511685_928511694 3 Left 928511685 2:32009816-32009838 CCGGCCGCACGCTTCCTGCAAGC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 928511694 2:32009842-32009864 AGGCGGCGACAAGTCGGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 83
928511685_928511690 -3 Left 928511685 2:32009816-32009838 CCGGCCGCACGCTTCCTGCAAGC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 928511690 2:32009836-32009858 AGCCAGAGGCGGCGACAAGTCGG 0: 1
1: 0
2: 0
3: 2
4: 71
928511685_928511692 1 Left 928511685 2:32009816-32009838 CCGGCCGCACGCTTCCTGCAAGC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 928511692 2:32009840-32009862 AGAGGCGGCGACAAGTCGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928511685 Original CRISPR GCTTGCAGGAAGCGTGCGGC CGG (reversed) Intronic