ID: 928511686

View in Genome Browser
Species Human (GRCh38)
Location 2:32009820-32009842
Sequence TCTGGCTTGCAGGAAGCGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 177}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928511686_928511696 5 Left 928511686 2:32009820-32009842 CCGCACGCTTCCTGCAAGCCAGA 0: 1
1: 0
2: 1
3: 13
4: 177
Right 928511696 2:32009848-32009870 CGACAAGTCGGCTGGGGTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 65
928511686_928511695 4 Left 928511686 2:32009820-32009842 CCGCACGCTTCCTGCAAGCCAGA 0: 1
1: 0
2: 1
3: 13
4: 177
Right 928511695 2:32009847-32009869 GCGACAAGTCGGCTGGGGTCCGG 0: 1
1: 0
2: 0
3: 5
4: 51
928511686_928511690 -7 Left 928511686 2:32009820-32009842 CCGCACGCTTCCTGCAAGCCAGA 0: 1
1: 0
2: 1
3: 13
4: 177
Right 928511690 2:32009836-32009858 AGCCAGAGGCGGCGACAAGTCGG 0: 1
1: 0
2: 0
3: 2
4: 71
928511686_928511692 -3 Left 928511686 2:32009820-32009842 CCGCACGCTTCCTGCAAGCCAGA 0: 1
1: 0
2: 1
3: 13
4: 177
Right 928511692 2:32009840-32009862 AGAGGCGGCGACAAGTCGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 34
928511686_928511698 29 Left 928511686 2:32009820-32009842 CCGCACGCTTCCTGCAAGCCAGA 0: 1
1: 0
2: 1
3: 13
4: 177
Right 928511698 2:32009872-32009894 GCACGTTCCTTCCTCGAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 69
928511686_928511694 -1 Left 928511686 2:32009820-32009842 CCGCACGCTTCCTGCAAGCCAGA 0: 1
1: 0
2: 1
3: 13
4: 177
Right 928511694 2:32009842-32009864 AGGCGGCGACAAGTCGGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 83
928511686_928511693 -2 Left 928511686 2:32009820-32009842 CCGCACGCTTCCTGCAAGCCAGA 0: 1
1: 0
2: 1
3: 13
4: 177
Right 928511693 2:32009841-32009863 GAGGCGGCGACAAGTCGGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928511686 Original CRISPR TCTGGCTTGCAGGAAGCGTG CGG (reversed) Intronic