ID: 928511687

View in Genome Browser
Species Human (GRCh38)
Location 2:32009822-32009844
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928511679_928511687 8 Left 928511679 2:32009791-32009813 CCGTCCTTCCCGGGGGTGGCAGC 0: 1
1: 0
2: 0
3: 24
4: 229
Right 928511687 2:32009822-32009844 GCACGCTTCCTGCAAGCCAGAGG 0: 1
1: 0
2: 1
3: 8
4: 104
928511684_928511687 -1 Left 928511684 2:32009800-32009822 CCGGGGGTGGCAGCGGCCGGCCG 0: 1
1: 0
2: 0
3: 34
4: 366
Right 928511687 2:32009822-32009844 GCACGCTTCCTGCAAGCCAGAGG 0: 1
1: 0
2: 1
3: 8
4: 104
928511683_928511687 0 Left 928511683 2:32009799-32009821 CCCGGGGGTGGCAGCGGCCGGCC 0: 1
1: 0
2: 1
3: 26
4: 323
Right 928511687 2:32009822-32009844 GCACGCTTCCTGCAAGCCAGAGG 0: 1
1: 0
2: 1
3: 8
4: 104
928511674_928511687 17 Left 928511674 2:32009782-32009804 CCGGGCACACCGTCCTTCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 928511687 2:32009822-32009844 GCACGCTTCCTGCAAGCCAGAGG 0: 1
1: 0
2: 1
3: 8
4: 104
928511681_928511687 4 Left 928511681 2:32009795-32009817 CCTTCCCGGGGGTGGCAGCGGCC 0: 1
1: 0
2: 6
3: 21
4: 250
Right 928511687 2:32009822-32009844 GCACGCTTCCTGCAAGCCAGAGG 0: 1
1: 0
2: 1
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type