ID: 928511688

View in Genome Browser
Species Human (GRCh38)
Location 2:32009825-32009847
Sequence CGCTTCCTGCAAGCCAGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 153}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928511679_928511688 11 Left 928511679 2:32009791-32009813 CCGTCCTTCCCGGGGGTGGCAGC 0: 1
1: 0
2: 0
3: 24
4: 229
Right 928511688 2:32009825-32009847 CGCTTCCTGCAAGCCAGAGGCGG 0: 1
1: 0
2: 1
3: 11
4: 153
928511683_928511688 3 Left 928511683 2:32009799-32009821 CCCGGGGGTGGCAGCGGCCGGCC 0: 1
1: 0
2: 1
3: 26
4: 323
Right 928511688 2:32009825-32009847 CGCTTCCTGCAAGCCAGAGGCGG 0: 1
1: 0
2: 1
3: 11
4: 153
928511684_928511688 2 Left 928511684 2:32009800-32009822 CCGGGGGTGGCAGCGGCCGGCCG 0: 1
1: 0
2: 0
3: 34
4: 366
Right 928511688 2:32009825-32009847 CGCTTCCTGCAAGCCAGAGGCGG 0: 1
1: 0
2: 1
3: 11
4: 153
928511681_928511688 7 Left 928511681 2:32009795-32009817 CCTTCCCGGGGGTGGCAGCGGCC 0: 1
1: 0
2: 6
3: 21
4: 250
Right 928511688 2:32009825-32009847 CGCTTCCTGCAAGCCAGAGGCGG 0: 1
1: 0
2: 1
3: 11
4: 153
928511674_928511688 20 Left 928511674 2:32009782-32009804 CCGGGCACACCGTCCTTCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 928511688 2:32009825-32009847 CGCTTCCTGCAAGCCAGAGGCGG 0: 1
1: 0
2: 1
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928511688 Original CRISPR CGCTTCCTGCAAGCCAGAGG CGG Intronic