ID: 928511689

View in Genome Browser
Species Human (GRCh38)
Location 2:32009830-32009852
Sequence TGTCGCCGCCTCTGGCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928511689_928511698 19 Left 928511689 2:32009830-32009852 CCTGCAAGCCAGAGGCGGCGACA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 928511698 2:32009872-32009894 GCACGTTCCTTCCTCGAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 69
928511689_928511696 -5 Left 928511689 2:32009830-32009852 CCTGCAAGCCAGAGGCGGCGACA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 928511696 2:32009848-32009870 CGACAAGTCGGCTGGGGTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 65
928511689_928511701 28 Left 928511689 2:32009830-32009852 CCTGCAAGCCAGAGGCGGCGACA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 928511701 2:32009881-32009903 TTCCTCGAGCCTGGTCCTGAGGG 0: 1
1: 0
2: 2
3: 13
4: 112
928511689_928511695 -6 Left 928511689 2:32009830-32009852 CCTGCAAGCCAGAGGCGGCGACA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 928511695 2:32009847-32009869 GCGACAAGTCGGCTGGGGTCCGG 0: 1
1: 0
2: 0
3: 5
4: 51
928511689_928511700 27 Left 928511689 2:32009830-32009852 CCTGCAAGCCAGAGGCGGCGACA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 928511700 2:32009880-32009902 CTTCCTCGAGCCTGGTCCTGAGG 0: 1
1: 0
2: 2
3: 19
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928511689 Original CRISPR TGTCGCCGCCTCTGGCTTGC AGG (reversed) Intronic