ID: 928511690

View in Genome Browser
Species Human (GRCh38)
Location 2:32009836-32009858
Sequence AGCCAGAGGCGGCGACAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928511686_928511690 -7 Left 928511686 2:32009820-32009842 CCGCACGCTTCCTGCAAGCCAGA 0: 1
1: 0
2: 1
3: 13
4: 177
Right 928511690 2:32009836-32009858 AGCCAGAGGCGGCGACAAGTCGG 0: 1
1: 0
2: 0
3: 2
4: 71
928511681_928511690 18 Left 928511681 2:32009795-32009817 CCTTCCCGGGGGTGGCAGCGGCC 0: 1
1: 0
2: 6
3: 21
4: 250
Right 928511690 2:32009836-32009858 AGCCAGAGGCGGCGACAAGTCGG 0: 1
1: 0
2: 0
3: 2
4: 71
928511683_928511690 14 Left 928511683 2:32009799-32009821 CCCGGGGGTGGCAGCGGCCGGCC 0: 1
1: 0
2: 1
3: 26
4: 323
Right 928511690 2:32009836-32009858 AGCCAGAGGCGGCGACAAGTCGG 0: 1
1: 0
2: 0
3: 2
4: 71
928511684_928511690 13 Left 928511684 2:32009800-32009822 CCGGGGGTGGCAGCGGCCGGCCG 0: 1
1: 0
2: 0
3: 34
4: 366
Right 928511690 2:32009836-32009858 AGCCAGAGGCGGCGACAAGTCGG 0: 1
1: 0
2: 0
3: 2
4: 71
928511685_928511690 -3 Left 928511685 2:32009816-32009838 CCGGCCGCACGCTTCCTGCAAGC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 928511690 2:32009836-32009858 AGCCAGAGGCGGCGACAAGTCGG 0: 1
1: 0
2: 0
3: 2
4: 71
928511679_928511690 22 Left 928511679 2:32009791-32009813 CCGTCCTTCCCGGGGGTGGCAGC 0: 1
1: 0
2: 0
3: 24
4: 229
Right 928511690 2:32009836-32009858 AGCCAGAGGCGGCGACAAGTCGG 0: 1
1: 0
2: 0
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928511690 Original CRISPR AGCCAGAGGCGGCGACAAGT CGG Intronic