ID: 928511694

View in Genome Browser
Species Human (GRCh38)
Location 2:32009842-32009864
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928511685_928511694 3 Left 928511685 2:32009816-32009838 CCGGCCGCACGCTTCCTGCAAGC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 928511694 2:32009842-32009864 AGGCGGCGACAAGTCGGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 83
928511684_928511694 19 Left 928511684 2:32009800-32009822 CCGGGGGTGGCAGCGGCCGGCCG 0: 1
1: 0
2: 0
3: 34
4: 366
Right 928511694 2:32009842-32009864 AGGCGGCGACAAGTCGGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 83
928511683_928511694 20 Left 928511683 2:32009799-32009821 CCCGGGGGTGGCAGCGGCCGGCC 0: 1
1: 0
2: 1
3: 26
4: 323
Right 928511694 2:32009842-32009864 AGGCGGCGACAAGTCGGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 83
928511686_928511694 -1 Left 928511686 2:32009820-32009842 CCGCACGCTTCCTGCAAGCCAGA 0: 1
1: 0
2: 1
3: 13
4: 177
Right 928511694 2:32009842-32009864 AGGCGGCGACAAGTCGGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 83
928511679_928511694 28 Left 928511679 2:32009791-32009813 CCGTCCTTCCCGGGGGTGGCAGC 0: 1
1: 0
2: 0
3: 24
4: 229
Right 928511694 2:32009842-32009864 AGGCGGCGACAAGTCGGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 83
928511681_928511694 24 Left 928511681 2:32009795-32009817 CCTTCCCGGGGGTGGCAGCGGCC 0: 1
1: 0
2: 6
3: 21
4: 250
Right 928511694 2:32009842-32009864 AGGCGGCGACAAGTCGGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type