ID: 928511776

View in Genome Browser
Species Human (GRCh38)
Location 2:32010097-32010119
Sequence TCGGCGGCCCGGCCCCGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 6, 3: 23, 4: 218}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928511776_928511795 19 Left 928511776 2:32010097-32010119 CCGCCGCGGGGCCGGGCCGCCGA 0: 1
1: 0
2: 6
3: 23
4: 218
Right 928511795 2:32010139-32010161 GGGCCAGGCGGCGACGGCGGCGG 0: 1
1: 0
2: 22
3: 213
4: 983
928511776_928511796 20 Left 928511776 2:32010097-32010119 CCGCCGCGGGGCCGGGCCGCCGA 0: 1
1: 0
2: 6
3: 23
4: 218
Right 928511796 2:32010140-32010162 GGCCAGGCGGCGACGGCGGCGGG 0: 1
1: 0
2: 7
3: 63
4: 456
928511776_928511798 23 Left 928511776 2:32010097-32010119 CCGCCGCGGGGCCGGGCCGCCGA 0: 1
1: 0
2: 6
3: 23
4: 218
Right 928511798 2:32010143-32010165 CAGGCGGCGACGGCGGCGGGCGG 0: 1
1: 1
2: 23
3: 182
4: 960
928511776_928511799 24 Left 928511776 2:32010097-32010119 CCGCCGCGGGGCCGGGCCGCCGA 0: 1
1: 0
2: 6
3: 23
4: 218
Right 928511799 2:32010144-32010166 AGGCGGCGACGGCGGCGGGCGGG 0: 1
1: 1
2: 48
3: 183
4: 947
928511776_928511782 -8 Left 928511776 2:32010097-32010119 CCGCCGCGGGGCCGGGCCGCCGA 0: 1
1: 0
2: 6
3: 23
4: 218
Right 928511782 2:32010112-32010134 GCCGCCGACCTCGGCCGGCCGGG 0: 1
1: 0
2: 2
3: 19
4: 241
928511776_928511800 28 Left 928511776 2:32010097-32010119 CCGCCGCGGGGCCGGGCCGCCGA 0: 1
1: 0
2: 6
3: 23
4: 218
Right 928511800 2:32010148-32010170 GGCGACGGCGGCGGGCGGGCCGG 0: 1
1: 2
2: 26
3: 193
4: 1095
928511776_928511793 13 Left 928511776 2:32010097-32010119 CCGCCGCGGGGCCGGGCCGCCGA 0: 1
1: 0
2: 6
3: 23
4: 218
Right 928511793 2:32010133-32010155 GGCGTGGGGCCAGGCGGCGACGG 0: 1
1: 0
2: 4
3: 39
4: 391
928511776_928511787 -1 Left 928511776 2:32010097-32010119 CCGCCGCGGGGCCGGGCCGCCGA 0: 1
1: 0
2: 6
3: 23
4: 218
Right 928511787 2:32010119-32010141 ACCTCGGCCGGCCGGGCGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 134
928511776_928511786 -2 Left 928511776 2:32010097-32010119 CCGCCGCGGGGCCGGGCCGCCGA 0: 1
1: 0
2: 6
3: 23
4: 218
Right 928511786 2:32010118-32010140 GACCTCGGCCGGCCGGGCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 106
928511776_928511791 7 Left 928511776 2:32010097-32010119 CCGCCGCGGGGCCGGGCCGCCGA 0: 1
1: 0
2: 6
3: 23
4: 218
Right 928511791 2:32010127-32010149 CGGCCGGGCGTGGGGCCAGGCGG 0: 1
1: 0
2: 5
3: 27
4: 498
928511776_928511789 4 Left 928511776 2:32010097-32010119 CCGCCGCGGGGCCGGGCCGCCGA 0: 1
1: 0
2: 6
3: 23
4: 218
Right 928511789 2:32010124-32010146 GGCCGGCCGGGCGTGGGGCCAGG 0: 1
1: 1
2: 5
3: 82
4: 720
928511776_928511785 -3 Left 928511776 2:32010097-32010119 CCGCCGCGGGGCCGGGCCGCCGA 0: 1
1: 0
2: 6
3: 23
4: 218
Right 928511785 2:32010117-32010139 CGACCTCGGCCGGCCGGGCGTGG 0: 1
1: 0
2: 3
3: 30
4: 218
928511776_928511781 -9 Left 928511776 2:32010097-32010119 CCGCCGCGGGGCCGGGCCGCCGA 0: 1
1: 0
2: 6
3: 23
4: 218
Right 928511781 2:32010111-32010133 GGCCGCCGACCTCGGCCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 133
928511776_928511794 16 Left 928511776 2:32010097-32010119 CCGCCGCGGGGCCGGGCCGCCGA 0: 1
1: 0
2: 6
3: 23
4: 218
Right 928511794 2:32010136-32010158 GTGGGGCCAGGCGGCGACGGCGG 0: 1
1: 0
2: 2
3: 38
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928511776 Original CRISPR TCGGCGGCCCGGCCCCGCGG CGG (reversed) Intronic
900117060 1:1033429-1033451 TCCGCGCCCCGCACCCGCGGGGG - Intronic
900143806 1:1149587-1149609 TCCGCGGGCCCGCCCCGTGGTGG + Intergenic
901381805 1:8879120-8879142 TTGGCGGCCCGGGCCTGCCGCGG + Intronic
902768309 1:18631243-18631265 CCGGAGACCAGGCCCCGCGGCGG - Exonic
903055532 1:20633641-20633663 GGGGCGGCCGGGCCCGGCGGCGG + Exonic
904143252 1:28369971-28369993 GCGGCGGCCCCGCCCCGCCCTGG - Intronic
904256929 1:29260081-29260103 TCGCCGGCCCCGCCCCTCGAGGG - Intronic
905648314 1:39639789-39639811 TCGGCGGCGCGTCACCGCGGGGG - Exonic
907296598 1:53459820-53459842 CCGGGGTTCCGGCCCCGCGGGGG - Exonic
913109057 1:115641848-115641870 CAGGTGGGCCGGCCCCGCGGCGG + Intergenic
914523048 1:148435079-148435101 GCGGCGGCCAGGGCCGGCGGCGG - Intergenic
914993171 1:152515755-152515777 TCCGAGGCCCAGCCCCGCGTGGG - Exonic
919931201 1:202222451-202222473 TCTGCGGCCCGGCCCCTGGGGGG + Intronic
920522011 1:206635102-206635124 CCGGAGGGCCGTCCCCGCGGTGG + Intergenic
921281493 1:213572190-213572212 TCGGAGGCCAAGCCCCGTGGAGG + Intergenic
922196507 1:223364265-223364287 CCGGCCGCGCGCCCCCGCGGAGG + Intergenic
924436724 1:244049037-244049059 TCCGCGCCCCGGCACCCCGGCGG + Intronic
1064208927 10:13347650-13347672 GCGGCGGCCCGTGCGCGCGGCGG - Intronic
1064418148 10:15168384-15168406 TCGGCCGCTCCGCCCCGCGATGG - Intronic
1067682754 10:48450884-48450906 CCGGCTCCCCGGCCCCGTGGGGG + Exonic
1067769891 10:49115524-49115546 GCGGCGGCCGGGCCAGGCGGCGG - Intergenic
1071532697 10:86401441-86401463 CCGTGGGCCCGACCCCGCGGGGG + Intergenic
1072591819 10:96833337-96833359 TCGGCCGCCCGGCCCCTCCCGGG - Intronic
1075629389 10:123991926-123991948 GCGGGGGCCCGGCGCCGAGGGGG - Intergenic
1081528469 11:43942743-43942765 GCGCCGGCCCGGGCCCGCGAGGG + Exonic
1081699966 11:45146774-45146796 TCGGCTGGCGGCCCCCGCGGAGG - Intronic
1083572762 11:63768978-63769000 GCGGCGGTGCGGGCCCGCGGGGG - Intergenic
1083644917 11:64166402-64166424 TCTGCCGCTCGGCCCCGCGGCGG + Intergenic
1083726317 11:64630378-64630400 TAGGCGGCGCGGGCCCGCGGAGG - Intronic
1085470232 11:76752947-76752969 CAGGCAGCCCGGCCCAGCGGAGG - Intergenic
1088495778 11:110430170-110430192 TCGGCGGCCCGGCCGGCCGGTGG + Exonic
1089046112 11:115503565-115503587 TCCCCGGCCCGGCCCCGCGGGGG - Intronic
1089397495 11:118145742-118145764 ACGGCGGCCCGGGACTGCGGCGG - Intronic
1094607318 12:31959698-31959720 GCGGCGGCCCGGCCCAGCTCCGG - Intronic
1096121090 12:49089918-49089940 TCGGCTGGACGGCCCCGCCGGGG + Exonic
1098320614 12:69239819-69239841 TCGGCGGCGCGGCCCAGAGGCGG - Intronic
1100186375 12:92144990-92145012 TCGGCGGCCCAGCCCCGGGGTGG - Intronic
1100260529 12:92928887-92928909 TCGGTCGCCCGGCCCGGGGGCGG - Intronic
1103649644 12:122422642-122422664 GCGCCCGCCCGGCCCCGCGGCGG - Intergenic
1103921634 12:124402364-124402386 TCAGCGGCCGGGCCCTGCAGGGG + Intronic
1112507513 13:99983814-99983836 CAGGCAGCGCGGCCCCGCGGGGG + Intronic
1117978646 14:61321502-61321524 TCCGCGGCCCGGCCCTGCGGTGG - Intronic
1120976883 14:90256768-90256790 TGGTCGGCCCCGGCCCGCGGTGG - Intronic
1121050383 14:90816108-90816130 TCGGGGGCCCGTTCCCGCGGAGG + Intronic
1121127589 14:91417916-91417938 CGGGCGGCCCCGCCCCTCGGCGG + Intergenic
1122065897 14:99174478-99174500 TGGGCGGCCCGGGCCCCGGGCGG - Exonic
1122270773 14:100567690-100567712 GCAGCGGCCCGGGCCGGCGGAGG + Intronic
1122486637 14:102086689-102086711 TCCCCCGCCCGGCCCCGCTGGGG - Intronic
1122558227 14:102592780-102592802 GCGCCCGCCCGGCCCCGCGCCGG + Exonic
1122917542 14:104865835-104865857 GAGGCGGCCGGGCCCGGCGGGGG - Intronic
1122960758 14:105092809-105092831 TCCGTGGCTCGGCCCCGCAGAGG - Intergenic
1127953505 15:63833483-63833505 TCTGTGCCCCGGCCCCGCTGTGG - Intronic
1128161048 15:65422987-65423009 TCGGGGGCCCGGGCCCGAGCTGG + Exonic
1128482906 15:68054828-68054850 TCGGCCGCCCCGCCCCTCCGTGG + Intronic
1128547735 15:68579188-68579210 GCGGCGGCCCGGGGCGGCGGCGG - Exonic
1130115417 15:81001382-81001404 AGCGCGGCCCGGCGCCGCGGCGG - Exonic
1131827738 15:96333827-96333849 TCGGCGGACCAGCCCCGAGCGGG + Intronic
1132314562 15:100880250-100880272 CGGGCGGCCCGGCCCCGCGCGGG - Intronic
1132482302 16:172730-172752 CCCGCCGCCCGGCCCCGCGCAGG + Intergenic
1132483150 16:176534-176556 CCCGCCGCCCGGCCCCGCGCAGG + Intergenic
1132754167 16:1474667-1474689 CCGCCAGCCCGGCCCCGCCGAGG + Intronic
1132761529 16:1510783-1510805 GCAGCGGCCCGGGCCGGCGGAGG - Exonic
1132788893 16:1673966-1673988 TCGGCGGCCAGGCTCAGCGATGG - Exonic
1133771276 16:8868503-8868525 ACGGCGGCCAGGCCCGGCGGGGG - Intronic
1134143561 16:11742579-11742601 TCGGCGGGCCGGCTCCGTCGCGG - Exonic
1139383652 16:66550027-66550049 CGGGCGGCCCAGCCCCGCAGCGG + Exonic
1141797599 16:86285641-86285663 TGGGCGGCCCAGCCCGGAGGGGG - Intergenic
1142513156 17:410521-410543 GCGGCGCCGCGGGCCCGCGGGGG + Exonic
1142712566 17:1731282-1731304 TAGGGGGACCGGCCCAGCGGAGG + Intronic
1142757569 17:2025000-2025022 CCGGTGGCCCGGCCCCGCAGGGG + Exonic
1144586739 17:16491922-16491944 TCGGGGGCCCGGCGCGGCGCCGG + Exonic
1144703197 17:17351725-17351747 TGGGCAGCCCGCCCCGGCGGAGG + Intergenic
1145694258 17:26774668-26774690 TCGGCGGCCAAAACCCGCGGTGG - Intergenic
1148664113 17:49361950-49361972 TCGGCGGTCCATCCCTGCGGCGG + Intronic
1148782646 17:50130281-50130303 TCGGCGCCCCGGCTGCTCGGCGG - Intergenic
1148786863 17:50149820-50149842 TGGGGAGCCCGGGCCCGCGGTGG + Exonic
1151551428 17:74824640-74824662 TCGGCAGCCCAGGCCCGAGGAGG - Intronic
1151705485 17:75764918-75764940 TCGGCGGCCGGGACAGGCGGCGG + Intronic
1151783835 17:76265638-76265660 CCCGCGGCCCGGCCCCGCGGCGG - Intronic
1152360917 17:79832628-79832650 TCGCCGGCCCTGCCCCACTGAGG - Intergenic
1152648561 17:81481582-81481604 GCGGCGGGCCGGCCCGGGGGAGG + Intergenic
1153688210 18:7567253-7567275 ACGGCCGCCCGGCGCCGCCGCGG - Exonic
1153900506 18:9614202-9614224 TGAGTGGCCCGGCCTCGCGGTGG - Intronic
1155507544 18:26548097-26548119 CTGGCGCCCCGGGCCCGCGGTGG - Intronic
1155654271 18:28176866-28176888 TGCGCAGCCCGGCCCCGCAGCGG + Intronic
1158357661 18:56638687-56638709 CCGGGGGCCCTGCCGCGCGGTGG - Intronic
1158427627 18:57353420-57353442 TCCGCGGGCCGGGCCCGGGGCGG + Intronic
1158718241 18:59899781-59899803 GCGGCGGCGCCGACCCGCGGCGG - Intergenic
1160024095 18:75204694-75204716 GCGCAGGCCCGGCGCCGCGGTGG + Intronic
1160706176 19:531370-531392 CCCGCGGCCCCGCCCCGCGCCGG + Intergenic
1160727251 19:622789-622811 CCGGGGACCCGGCCGCGCGGAGG + Intronic
1160994386 19:1875975-1875997 TCGCAGCCCCGACCCCGCGGCGG + Intergenic
1162032954 19:7925229-7925251 TCAGAGGGCCGGCCCGGCGGGGG - Exonic
1162113371 19:8413393-8413415 GCGGCCGCCCGGCCCGGCCGCGG + Intronic
1163145959 19:15379493-15379515 TTGGCCGCCAGGCCCCGAGGAGG - Intronic
1164639148 19:29812047-29812069 TCGGCGGGCCGAGCGCGCGGCGG - Exonic
1165994277 19:39833385-39833407 TGGCCCGGCCGGCCCCGCGGCGG + Exonic
1166547037 19:43639882-43639904 TCGGCGCCCCGCCCCCGGGCGGG - Intergenic
1166780593 19:45340711-45340733 CCGGCTGCCCCGCCCCTCGGAGG + Intronic
1167250070 19:48394812-48394834 TCGGGGGGCAGGCCCCGGGGCGG - Intergenic
1168346633 19:55653037-55653059 TCTCCGCCCTGGCCCCGCGGAGG + Exonic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
925959412 2:9002083-9002105 TCATCCTCCCGGCCCCGCGGAGG - Intronic
927713972 2:25341274-25341296 GCGGGGGCCGGGCCCCGCGCAGG - Intronic
928511776 2:32010097-32010119 TCGGCGGCCCGGCCCCGCGGCGG - Intronic
934275661 2:91571459-91571481 GCGGCGGCGCGGCGGCGCGGCGG + Intergenic
935904641 2:107828407-107828429 GCCTCGACCCGGCCCCGCGGCGG + Intronic
935904768 2:107828907-107828929 GCCTCGACCCGGCCCCGCGGCGG + Intronic
937933052 2:127220184-127220206 TGGGCGGCGGGGCCCCGCGGCGG - Intergenic
945245250 2:207711705-207711727 CCCGCGGCCCGGCCCCGGGCAGG - Intronic
946311323 2:218883886-218883908 GCGCCGGCCCGGCCCAGCCGGGG - Intronic
946412641 2:219522741-219522763 ACCGCCGCCCGCCCCCGCGGCGG - Intronic
947846933 2:233251971-233251993 GGGGCGGGCGGGCCCCGCGGAGG + Intronic
948205069 2:236159288-236159310 TCGGAGGCCCGGCCAGGCTGGGG + Intergenic
948368936 2:237475331-237475353 CCCGCGGCCCGGCCCCGCCTCGG - Intergenic
948801556 2:240435630-240435652 CCGCCGGCCCGGCCCCTAGGCGG - Intergenic
1172379512 20:34476403-34476425 TCGGCGACCCGGCCGGCCGGTGG - Intronic
1173251388 20:41365964-41365986 TCTGCAGCCCGGCCACGCTGGGG + Intronic
1175992052 20:62794510-62794532 GCCCCGGCCCCGCCCCGCGGTGG + Intergenic
1176547913 21:8209337-8209359 TCGTCGGCCCGCCCGCGAGGAGG - Intergenic
1176549460 21:8214914-8214936 ACGCCGGCGCGCCCCCGCGGGGG - Intergenic
1176557355 21:8259143-8259165 ACGCCGGCGCGCCCCCGCGGGGG - Intergenic
1176568388 21:8397948-8397970 ACGCCGGCGCGCCCCCGCGGGGG - Intergenic
1176576297 21:8442178-8442200 ACGCCGGCGCGCCCCCGCGGGGG - Intergenic
1178327896 21:31660061-31660083 GCGCAGGCCCAGCCCCGCGGCGG - Intronic
1179294935 21:40053318-40053340 TTGGAGGTCCGGCCCCGTGGCGG + Intronic
1179411988 21:41168827-41168849 TCTCCCGCCCAGCCCCGCGGAGG - Intronic
1181147401 22:20858700-20858722 GCGGCGGCCCCGGCCCGGGGAGG - Exonic
1182294939 22:29307088-29307110 GCGGCGGCCCGGCCCGGCTCCGG + Exonic
1183548470 22:38467935-38467957 TGGGCGGCCCGGCGACGCGGGGG - Intergenic
1184086828 22:42270458-42270480 TCGGGCGCCCGGGCCGGCGGCGG + Intronic
1184652114 22:45924195-45924217 TCGGCAGCCCAGCCCTGCCGGGG + Intronic
1185321098 22:50200614-50200636 CCGGCGGCCCAGAACCGCGGCGG + Intergenic
1185345020 22:50307315-50307337 TCGGGGGACGGGCCCGGCGGCGG - Intronic
1185417952 22:50720357-50720379 TCGTAGGCGCGGCCCGGCGGGGG - Intergenic
1203254347 22_KI270733v1_random:131236-131258 ACGCCGGCGCGCCCCCGCGGGGG - Intergenic
1203262403 22_KI270733v1_random:176315-176337 ACGCCGGCGCGCCCCCGCGGGGG - Intergenic
950618125 3:14178628-14178650 ACGCCGGCCCCGCCCCGAGGCGG + Exonic
952287237 3:31981025-31981047 GCGGCGGCCGGGCTCGGCGGCGG - Exonic
952816581 3:37452376-37452398 TGGGCGGCCCGGCTGCGCCGAGG + Exonic
954763882 3:52897225-52897247 GCCGCGGCCCGGCCCCCCTGGGG - Intronic
961446258 3:126983129-126983151 TCGGCTGCGCGGCCACGCAGCGG + Intergenic
961446281 3:126983197-126983219 TCGGCGGCCCCGCGGCGGGGCGG + Intergenic
961539440 3:127590080-127590102 TCGGCGACCCGGTCCGGCGCGGG - Intronic
961828707 3:129612265-129612287 GCGGCGGCCCTGCCCCTCTGAGG - Intergenic
967904088 3:194486746-194486768 GGGCCGGCCCGGCCCCGCCGCGG - Intronic
968199559 3:196740264-196740286 GCGGCTCCCCGGCCCCGCGCGGG - Intronic
969680552 4:8640993-8641015 TTTGCGGCCCAGCCCCGCAGAGG + Intergenic
970333179 4:15004345-15004367 GCGGCGGCCTGGCCGCGCCGCGG + Intronic
974047274 4:56908356-56908378 GCGGCGGCCCCGCCGGGCGGGGG + Intronic
974055158 4:56976937-56976959 GCGGCGGCCCGGCCCCTCCCTGG - Exonic
975689523 4:76950019-76950041 GCGGGTGCTCGGCCCCGCGGCGG + Intronic
979278198 4:118836206-118836228 CCGGTGGCCCCGCCCCGCGGCGG - Intronic
980130059 4:128809957-128809979 TGCGCGTCCCGGTCCCGCGGCGG + Intronic
981516777 4:145618970-145618992 GCGGCGGCCGGGACCCCCGGAGG - Exonic
983649805 4:170026562-170026584 GCTGCGGAGCGGCCCCGCGGAGG + Intronic
984734947 4:183099675-183099697 CCGGAGACCCGGCCGCGCGGGGG + Intronic
985444536 4:190014928-190014950 CCGGCGGCCAGGCCTCGCGCAGG - Intergenic
986540489 5:8839836-8839858 CCGACGGCCCAGCCCCCCGGTGG - Intergenic
992105578 5:73447401-73447423 TCGGCGGCCGCGCCGTGCGGTGG + Exonic
992473185 5:77077509-77077531 GCCGCCGCCCGGCCCCGCTGCGG - Exonic
995402426 5:111757714-111757736 TCTGCGCCCCGGCCCCGCCCCGG + Intronic
997453988 5:134004517-134004539 CCGGCAGCCCGGCCGCGGGGAGG - Intronic
998424201 5:142013029-142013051 CCGGCGGCCCGGCCCCGCGCGGG + Intronic
1002098069 5:176843789-176843811 TCGGCGGCTGGGCCCGGCCGTGG + Intronic
1002185860 5:177454603-177454625 TCGGCGCCCGGGCTCCGCGGCGG + Intronic
1002925808 6:1605100-1605122 TCTCCGGCCCGGCGCCGCAGCGG - Intergenic
1003212423 6:4079353-4079375 TGGGCTGCGCAGCCCCGCGGGGG - Exonic
1003290741 6:4776489-4776511 CAGCCCGCCCGGCCCCGCGGCGG + Exonic
1003573485 6:7271249-7271271 TCGGCGGCCCTGCCCTGCTCTGG - Intronic
1005636440 6:27757625-27757647 ACGGGGGCCCGGCCCCGCGGCGG - Intergenic
1007557792 6:42781921-42781943 GCGGCGCCCCGGCCCGGCGCGGG + Intronic
1011603704 6:89081733-89081755 TCGGCGTTCCGGGCGCGCGGCGG + Intronic
1012548355 6:100446690-100446712 CCGGCGCCCAGGCCCCGCGCGGG - Intronic
1012939649 6:105403118-105403140 CCGGCGGGCGGGCCCAGCGGCGG + Intergenic
1013272877 6:108559694-108559716 GCGGCGGGCCGGGCGCGCGGCGG - Intergenic
1014272564 6:119349922-119349944 CCGCCGGCCGGGCCCCGCCGAGG - Intergenic
1015149185 6:130019649-130019671 TCGGCCGCCGAGCCCCGCCGCGG - Intronic
1015149216 6:130019827-130019849 GAGGCGGCGCGGGCCCGCGGCGG + Intronic
1015626349 6:135183120-135183142 TGCGCGGCCCCGCCCCGCGGGGG - Intronic
1018686337 6:166307525-166307547 GCGGCGGCCCTGGCCGGCGGTGG + Exonic
1018686506 6:166308052-166308074 CCGGAGGCCCTGCGCCGCGGGGG - Exonic
1019474391 7:1236872-1236894 TCGGCCTCCCAGCCCCGCCGAGG + Exonic
1019689572 7:2403310-2403332 CCGGCGGACCGGGCGCGCGGCGG - Intergenic
1021717289 7:23471223-23471245 GGGGCGGCCCGGCCCCGGAGTGG + Intergenic
1022107299 7:27205551-27205573 CAGGCGGCCTGGGCCCGCGGGGG + Intergenic
1023805455 7:43869608-43869630 ACCGCGGCCCCGCCCCGCAGAGG - Intronic
1024579846 7:50793019-50793041 CCGGCGCCCCGGGCCCGCAGCGG - Intronic
1025738956 7:64181636-64181658 GCGCCGGGCCGGCCCCGCGGTGG + Intronic
1026672646 7:72403263-72403285 TCGGGGGCCTGGCTCCTCGGCGG + Exonic
1029270482 7:99374447-99374469 TCGGAGGTCCAGCCCAGCGGCGG + Intronic
1029569920 7:101362765-101362787 TCGGCGGTCCGGGGCCGAGGAGG - Intergenic
1029983404 7:104900017-104900039 TTGGCGGCCAGGCACGGCGGTGG - Intronic
1033299925 7:140176645-140176667 GCGGCGGCCCGGCCCGAGGGAGG + Intronic
1035129782 7:156640912-156640934 TCGCCGGCCCGGCTCGGAGGAGG - Exonic
1036787981 8:11700626-11700648 CCGGCGCCCAGGCCCAGCGGGGG + Intronic
1037589836 8:20303514-20303536 TCTCCGGCCCGGCCCAGAGGAGG - Intronic
1037807532 8:22066904-22066926 TCGGCGGCCCCGGCCCGGGGCGG - Intronic
1038176384 8:25184885-25184907 GCGGCGACCTCGCCCCGCGGCGG - Exonic
1038554120 8:28494558-28494580 GCGGGGGCCCGGGCCCGCGGTGG + Intronic
1038760916 8:30384172-30384194 TCGGGGACCCTGCCCCGCCGGGG - Intergenic
1038816817 8:30912641-30912663 TCGGCTGCCCTGGCCCTCGGAGG + Intergenic
1040065440 8:43140798-43140820 GCTGCGGCCGGGCCCCGCGGAGG + Intronic
1043847252 8:85177400-85177422 ATCGCGTCCCGGCCCCGCGGTGG - Exonic
1044698835 8:94948970-94948992 TGGGCGGCCGGGCCCGGCGGCGG + Intronic
1049409123 8:142464666-142464688 CCGGCGGCCCGGCCCGGGGCCGG - Exonic
1049585414 8:143430525-143430547 TCGGCGCCGCCGCCCCGCGCCGG - Intergenic
1049621476 8:143600133-143600155 GCGGAGGCCCAGCCCCACGGGGG - Exonic
1052809473 9:33044483-33044505 TGCGCGGCCCGACCCCGCCGCGG + Exonic
1053072901 9:35111522-35111544 TCGGCGGCGCGGAGCCGGGGCGG - Exonic
1053381241 9:37651014-37651036 AGGGCGGCCCCGCCCAGCGGCGG - Intronic
1053435011 9:38068730-38068752 TCGGCGCCCCGGCCCCGGCGGGG + Exonic
1057259676 9:93576689-93576711 CCGGGGGCCGGGCCGCGCGGGGG - Exonic
1057259760 9:93576963-93576985 GCGGCGGCCCGTCCCCGAGCCGG - Intronic
1058885721 9:109320316-109320338 GCGGCGGCCGGGCCCCCCCGTGG + Exonic
1059176690 9:112175028-112175050 GCGCCGGCCCGGCCCAGGGGCGG + Intronic
1059470938 9:114504722-114504744 TCGGCGGCCGGGGCGGGCGGCGG - Exonic
1060114373 9:120928913-120928935 CGGGCGCCCCGGCCCCGCAGGGG - Intronic
1060114486 9:120929242-120929264 TCGCTCGCCCCGCCCCGCGGCGG - Intergenic
1060514562 9:124257890-124257912 GGGGCGGCGCGGCCCCGCGGCGG + Intronic
1062363626 9:136198841-136198863 GCGGCCGCCCGGCTCTGCGGGGG + Intronic
1062547576 9:137070512-137070534 TCGCCGGGCCGGCCCCTCCGTGG - Exonic
1062574532 9:137200158-137200180 GCCGCGCCCGGGCCCCGCGGTGG - Exonic
1203470748 Un_GL000220v1:114380-114402 ACGCCGGCGCGCCCCCGCGGGGG - Intergenic
1203478569 Un_GL000220v1:158352-158374 ACGCCGGCGCGCCCCCGCGGGGG - Intergenic
1189001940 X:36957507-36957529 ACCGCGGCCCTGGCCCGCGGAGG - Intergenic
1190243644 X:48676693-48676715 TGGCCGACCCGGCCCCGCGCGGG + Intronic
1196442353 X:115728416-115728438 TCCACCGCCCGACCCCGCGGCGG + Intergenic
1196443204 X:115732488-115732510 TCCACCGCCCGACCCCGCGGCGG - Intergenic
1196443862 X:115735456-115735478 TCCACCGCCCGACCCCGCGGCGG - Intergenic
1196445525 X:115844403-115844425 TCCACCGCCCGACCCCGCGGCGG - Intergenic
1196446196 X:115847384-115847406 TCCACCGCCCGACCCCGCGGCGG - Intergenic
1196446867 X:115850365-115850387 TCCACCGCCCGACCCCGCGGCGG - Intergenic
1196447535 X:115853348-115853370 TCCACCGCCCGACCCCGCGGCGG - Intergenic
1196448206 X:115856327-115856349 TCCACCGCCCGACCCCGCGGCGG - Intergenic
1196448875 X:115859318-115859340 TCCACCGCCCGACCCCGCGGCGG - Intergenic
1196449546 X:115862309-115862331 TCCACCGCCCGACCCCGCGGCGG - Intergenic
1196450215 X:115865292-115865314 TCCACCGCCCGACCCCGCGGCGG - Intergenic
1196450885 X:115868277-115868299 TCCACCGCCCGACCCCGCGGCGG - Intergenic
1196451556 X:115871256-115871278 TCCACCGCCCGACCCCGCGGCGG - Intergenic
1196452227 X:115874243-115874265 TCCACCGCCCGACCCCGCGGCGG - Intergenic
1196452897 X:115877212-115877234 TCCACCGCCCGACCCCGCGGCGG - Intergenic
1196453567 X:115880205-115880227 TCCACCGCCCGACCCCGCGGCGG - Intergenic
1196454236 X:115883214-115883236 TCCACCGCCCGACCCCGCGGCGG - Intergenic
1196455317 X:115888286-115888308 TCCACCGCCCGACCCCGCGGCGG - Intergenic
1196684166 X:118496259-118496281 CCGGCCGCCCGGCACGGCGGAGG + Intronic
1197709387 X:129654826-129654848 TTCGCGGCGCTGCCCCGCGGCGG - Exonic
1200092926 X:153644246-153644268 GCGCTGGCCCGGCCCGGCGGAGG + Intronic