ID: 928518203

View in Genome Browser
Species Human (GRCh38)
Location 2:32063656-32063678
Sequence CCGAGGAAGGAGAAAGGGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 727
Summary {0: 1, 1: 0, 2: 3, 3: 72, 4: 651}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928518188_928518203 19 Left 928518188 2:32063614-32063636 CCGAGCCACCGACTGCAGGAGGA 0: 1
1: 0
2: 0
3: 9
4: 157
Right 928518203 2:32063656-32063678 CCGAGGAAGGAGAAAGGGGCGGG 0: 1
1: 0
2: 3
3: 72
4: 651
928518193_928518203 11 Left 928518193 2:32063622-32063644 CCGACTGCAGGAGGAGAAGGGGT 0: 1
1: 0
2: 1
3: 24
4: 320
Right 928518203 2:32063656-32063678 CCGAGGAAGGAGAAAGGGGCGGG 0: 1
1: 0
2: 3
3: 72
4: 651
928518186_928518203 20 Left 928518186 2:32063613-32063635 CCCGAGCCACCGACTGCAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 198
Right 928518203 2:32063656-32063678 CCGAGGAAGGAGAAAGGGGCGGG 0: 1
1: 0
2: 3
3: 72
4: 651
928518189_928518203 14 Left 928518189 2:32063619-32063641 CCACCGACTGCAGGAGGAGAAGG 0: 1
1: 0
2: 2
3: 23
4: 270
Right 928518203 2:32063656-32063678 CCGAGGAAGGAGAAAGGGGCGGG 0: 1
1: 0
2: 3
3: 72
4: 651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928518203 Original CRISPR CCGAGGAAGGAGAAAGGGGC GGG Exonic
900432441 1:2609291-2609313 CCGAGGCAGGGGACGGGGGCGGG - Intronic
900700309 1:4044209-4044231 AAGAGGAAGAAGAAAGAGGCTGG - Intergenic
900758061 1:4451241-4451263 ACTGGGAAGGAGGAAGGGGCTGG - Intergenic
900806573 1:4771524-4771546 CACAGGAAGGACAAGGGGGCTGG - Intronic
900940769 1:5797220-5797242 CTGAGTAGGGAGCAAGGGGCTGG - Intergenic
901381871 1:8879361-8879383 CGCAGCAAGGAGAAAGGGACAGG - Intergenic
901661985 1:10804365-10804387 GGGAGGGAAGAGAAAGGGGCAGG - Intergenic
902192851 1:14775729-14775751 TTGAAGCAGGAGAAAGGGGCAGG + Intronic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902545983 1:17190624-17190646 CAGAGAACGGAGAAAGGAGCTGG - Intergenic
902791346 1:18770330-18770352 CCGAGGAAGGAGAGTAGGGAGGG - Intergenic
903485686 1:23688284-23688306 CCGAGGCAGGAGAATCAGGCAGG - Intergenic
903828961 1:26163638-26163660 CCGAGAAGGAAGAAGGGGGCCGG - Intergenic
904045765 1:27607376-27607398 ACGGGGGAGGGGAAAGGGGCTGG - Intergenic
904087102 1:27916848-27916870 CTGAGGCAGGAGAAAGGAGGAGG - Intergenic
904087193 1:27917140-27917162 AAGAGGAAGGAGGAAGGGGAAGG - Intergenic
904115718 1:28160467-28160489 CTGAGGAAGGAGGATGGGTCAGG + Intronic
904274193 1:29369653-29369675 CACAGGAAGGAGAGAGGGGCAGG - Intergenic
904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG + Intergenic
904364481 1:30001743-30001765 CACAGGAGGGAGAGAGGGGCAGG - Intergenic
904423773 1:30410440-30410462 CACAGGAAGGAGAGAGGGGCAGG + Intergenic
904490823 1:30858054-30858076 CTGAGGGAGGGGACAGGGGCAGG - Intergenic
904610121 1:31721196-31721218 CTGAGGAAGGAGGAGGGAGCTGG + Intergenic
904919612 1:33996766-33996788 GAAAGGAAGGAGAAAAGGGCGGG + Intronic
904930148 1:34081515-34081537 CCGAGGCAGGAGAATCAGGCAGG - Intronic
905396510 1:37669909-37669931 CCAAGGAAGGAGACAGAGGAAGG - Intergenic
906090250 1:43172561-43172583 CCGGGGGAGGGGAAAGGGGAGGG + Exonic
906570168 1:46831111-46831133 CCCAGGAAGCAGAAGGGGTCGGG - Intergenic
906714261 1:47955297-47955319 TGGTGGAAGGAGAAAGGGACTGG - Intronic
907317508 1:53581858-53581880 CCTAGGGAGGAGGAAGGGGGTGG - Intronic
907600049 1:55760269-55760291 CCCAGGAAGAAGAAGGGGTCAGG + Intergenic
907837599 1:58125950-58125972 AGGAGGAAGGAGAAGGGGACAGG + Intronic
908470363 1:64438233-64438255 GGGAGGAAAGAGAAAGGGCCAGG - Intergenic
909087065 1:71180764-71180786 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
910465285 1:87492630-87492652 CCGTGGGAGGAGAGACGGGCTGG + Intergenic
912214008 1:107586473-107586495 AGGAGGAAGGAGAAAGGGAAGGG + Intronic
912817115 1:112838170-112838192 CCTGGGGAGGGGAAAGGGGCTGG - Intergenic
912843477 1:113059534-113059556 CCTTGGAAGGATAAAGGGGCAGG + Intergenic
913300042 1:117360846-117360868 TAGAGGAAGGAGAAAGGGCATGG - Intergenic
913571084 1:120120563-120120585 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914291894 1:146281541-146281563 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914552938 1:148732324-148732346 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914664174 1:149819165-149819187 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
914671588 1:149874677-149874699 CTGAGGCAGGAGAATGAGGCAGG + Intronic
915294255 1:154909065-154909087 CCGAGGCAGGAGGAAGGGATGGG + Intergenic
915301286 1:154953048-154953070 CTGAGGAGGGAGAAGGGGGTTGG - Intronic
915325686 1:155080329-155080351 GCGAGGAGGGAGAGAGGGGGAGG - Intronic
915354690 1:155249010-155249032 CTGAGAAAGGAGACAGTGGCCGG - Intronic
915555342 1:156657970-156657992 CCGGGGAAGGGGAAAGGAGAGGG - Intronic
916037191 1:160932758-160932780 CTGAGGCAGGAGAAAAAGGCAGG - Intergenic
916101133 1:161394224-161394246 TCTGGGGAGGAGAAAGGGGCTGG - Intergenic
916223278 1:162465499-162465521 CCGAGGCAGGAGAATCAGGCAGG - Intergenic
916461485 1:165029262-165029284 TCCAGGAAGGGGAGAGGGGCTGG + Intergenic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
916810354 1:168300261-168300283 CGAAGGAAGGAGAATGGGGAAGG + Intronic
916993493 1:170270112-170270134 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
918022871 1:180711513-180711535 CTGAGGCAGGAGAATGAGGCAGG + Intronic
918043623 1:180928054-180928076 AGGAGGAGGGAGAAAGGGCCCGG - Intronic
918118444 1:181516944-181516966 CAGAGGAAGGAGGAAGAGCCAGG - Intronic
919525929 1:198650379-198650401 GGGAGGATGGAGAAAGGGGATGG + Intronic
919691383 1:200531356-200531378 AAGAGGGAGGGGAAAGGGGCAGG + Intergenic
919920671 1:202164797-202164819 CAGAGGAGAGAGCAAGGGGCAGG - Intergenic
920173299 1:204084693-204084715 GAGAGGAGGGAGGAAGGGGCTGG - Intronic
920520293 1:206619487-206619509 CCAAGGAAGGGGTAAGGGGGTGG + Intergenic
920529568 1:206692172-206692194 CCAAGCAAGGAGACAGTGGCTGG - Intronic
920631790 1:207659710-207659732 CCAAGGAAGTACAAAGGGTCAGG + Intronic
920975975 1:210785779-210785801 CCGAGGAGAGAGCAAAGGGCTGG - Intronic
921149770 1:212390653-212390675 CCCGGGAAGCAGAAAGGGTCAGG + Intronic
921191560 1:212713420-212713442 CAGATGGGGGAGAAAGGGGCTGG - Intergenic
921225527 1:213015571-213015593 CGGAGGGAGGAGAGAGGGGCGGG - Intronic
921357544 1:214299982-214300004 ACTAGGAAGGAGAGAGGGGAGGG + Intronic
921447182 1:215260718-215260740 CCCAGGAAGCACAAAGGGTCGGG - Intergenic
921768053 1:218996873-218996895 TCCAGGAAAGAGAAAGGGGCTGG + Intergenic
921908978 1:220527755-220527777 CCGAGGTAGGAGAAAAGGAGGGG + Intergenic
922002463 1:221493904-221493926 TTGAGGAAGGAGAGAGGGGAAGG - Intergenic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922596307 1:226816113-226816135 CAGAGGAAGGAAGATGGGGCAGG - Intergenic
922983924 1:229851406-229851428 CCTGGGAGGGAGACAGGGGCTGG - Intergenic
923116003 1:230938454-230938476 CCCAGGCAGGAGGAAGGGCCAGG + Intronic
923566439 1:235079988-235080010 CAGAGGAAGGAGAAAATGGGAGG - Intergenic
923614743 1:235527571-235527593 CCCAGGTTGGGGAAAGGGGCAGG - Intergenic
923676090 1:236081907-236081929 TTGGGGAAGGAGAAAAGGGCAGG - Intergenic
923676105 1:236081962-236081984 CCTATGAAGGATAAAGGGGAAGG - Intergenic
924371823 1:243359126-243359148 AAGAGGAAGGAGGAAGGTGCTGG - Intronic
924626874 1:245702799-245702821 CCGTGGAAGGAGAAAAGGATGGG + Exonic
924645341 1:245872429-245872451 CCGGTGAAGGAGAAGGCGGCAGG - Intronic
924821189 1:247492041-247492063 CTGGGGTGGGAGAAAGGGGCTGG + Intergenic
1063721679 10:8588658-8588680 CCGGCAAAGGAGAAAGAGGCAGG + Intergenic
1064380184 10:14834927-14834949 TTGAGTAAGGAGAAAGGAGCAGG + Intronic
1064452225 10:15452964-15452986 TGGAGGAAGAAGAATGGGGCTGG + Intergenic
1064913897 10:20435079-20435101 CCAAGGAAGGAGAAATGGCATGG + Intergenic
1065460012 10:25950702-25950724 CTGAGGAAGGAGAAATGAGTAGG + Intronic
1065588170 10:27240600-27240622 CCGGGGGAGGAGGAAGGAGCCGG - Intronic
1065723197 10:28645510-28645532 GAGCGGAAGGAGAAAGGAGCAGG - Intergenic
1065806128 10:29395004-29395026 CTCAGAAAGGAGAAAGGGGATGG - Intergenic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1066625199 10:37398856-37398878 CAGAGGAGGGAGAAAGGGAGGGG - Intergenic
1066721752 10:38346837-38346859 CCGAACATGGAGAAAAGGGCAGG - Intergenic
1066746459 10:38606486-38606508 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1067047044 10:42990718-42990740 CAGAGGAAGGAGACAGGGGTGGG + Intergenic
1067695981 10:48535996-48536018 CTGTGGAAGGAGAAAGGCGCAGG + Intronic
1068654899 10:59564436-59564458 CCAAGGAAGGAGAAGAGGGCAGG + Intergenic
1068725723 10:60300462-60300484 CCTAGGAAGGAGGTAGGAGCTGG + Intronic
1069553015 10:69377426-69377448 TCGAGCAAGGAGCAAGGAGCTGG + Intronic
1070589858 10:77794160-77794182 CAGAGGAAGGAAAGAGGGCCTGG - Intronic
1070972463 10:80578849-80578871 ACGAGGAAGGAGAGAAGGGATGG + Intronic
1071797435 10:89021553-89021575 CCAGGGAAGGAGCAAGGGTCAGG - Intergenic
1072299398 10:94044686-94044708 CCGAGGAAGGTGGAAGAGACAGG - Intronic
1073737496 10:106366502-106366524 CCTAGAGTGGAGAAAGGGGCAGG - Intergenic
1075645222 10:124092476-124092498 AGGAGGAAGGAGGAGGGGGCGGG + Intronic
1075667719 10:124242960-124242982 CTGAGGAGGGAGAAACAGGCGGG + Intergenic
1076030137 10:127150336-127150358 CTGAGCAAAGAGAAAGGGGAGGG - Intronic
1076075076 10:127527181-127527203 CCCAGGAAGGAGAGAGAGACAGG + Intergenic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1076838411 10:133032723-133032745 ATGAGGAGGGAGAAGGGGGCAGG - Intergenic
1077010728 11:378095-378117 CAGAGGATGGAGACAGGGCCAGG + Intronic
1077061026 11:617925-617947 CCCAGGATGGAGAACAGGGCAGG - Intronic
1077295934 11:1826348-1826370 CCGAGCAAGTAGAAAGGGGGCGG + Intergenic
1077324705 11:1958713-1958735 GCCAGGGAGGAGAAAGGGGCTGG + Intronic
1077404130 11:2375243-2375265 CAGAGCCAGGGGAAAGGGGCTGG - Intergenic
1077662459 11:4082058-4082080 CCCAGGAAGGAGAAAAGGTAAGG - Intronic
1077730588 11:4725080-4725102 CTGAAGAAGGAGCAAGGGGGAGG - Intronic
1077799938 11:5527401-5527423 GCAAGGAAGGAGAAGAGGGCAGG + Intronic
1077801615 11:5544718-5544740 GCGAGGATGGAGAAAAAGGCAGG + Exonic
1079708427 11:23651320-23651342 TCCAGGAAGAAGAAAGAGGCTGG - Intergenic
1080174373 11:29343985-29344007 CACAGGCAGGAGAAAAGGGCAGG + Intergenic
1080302892 11:30804229-30804251 TCCAGGAAGCAGAGAGGGGCTGG + Intergenic
1080642685 11:34166893-34166915 ACGAGGGAGGAGAAAAGGGAAGG + Intronic
1081206439 11:40281003-40281025 CAGAGGGAGGAGAAAAGGGATGG + Intronic
1081246930 11:40778630-40778652 AGGAGGAAGGAAAAAGGGGCTGG + Intronic
1081812596 11:45922286-45922308 ACGAGGGAGGAGGAGGGGGCCGG - Intronic
1083179835 11:60978204-60978226 CAGAGAAAGGACAAAGGGGGTGG + Intronic
1083402450 11:62433304-62433326 AAGAGGAAAGAGAAAGGGGAGGG + Intergenic
1083544325 11:63537768-63537790 AAGAGGGAGGAGAAAGGAGCAGG - Intronic
1083611667 11:64007329-64007351 CCGAGGAAGGAGGGAGGGATGGG + Intronic
1084064093 11:66693523-66693545 CCCAGGAAGGAGAGAGGCACAGG - Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084559120 11:69892871-69892893 GCTGGGAAGGAGAGAGGGGCTGG - Intergenic
1084712309 11:70851480-70851502 AGCAGAAAGGAGAAAGGGGCAGG - Intronic
1084723358 11:70924023-70924045 ACGAGGGAGCAGACAGGGGCAGG + Intronic
1085047314 11:73360998-73361020 GGGAGGAAGGGGAATGGGGCAGG + Intronic
1085296207 11:75433192-75433214 CTGCGGGAGGACAAAGGGGCTGG + Intergenic
1085563043 11:77489545-77489567 CCGAGGCAGGAGAATCAGGCAGG - Intergenic
1086370688 11:86152634-86152656 TGGAGGAAGGAGATAGGGTCAGG - Intergenic
1086457073 11:86969531-86969553 AGGAAGAAGGAGAAAGGGGATGG - Intergenic
1086907394 11:92433493-92433515 CCCAGGAAGTAGAAGGGGTCAGG - Intronic
1088759205 11:112913228-112913250 CAGAGGCAGGAGAAAAAGGCTGG + Intergenic
1089126680 11:116181198-116181220 CTGAGGAGGGAAGAAGGGGCGGG - Intergenic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090428529 11:126627287-126627309 ATGAGGAAGGAGACAGAGGCTGG + Intronic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090484092 11:127096603-127096625 CAGAGGAAGGATTAAAGGGCTGG + Intergenic
1202807684 11_KI270721v1_random:13890-13912 GCCAGGGAGGAGAAAGGGGCTGG + Intergenic
1091755407 12:3048086-3048108 GCAAGGAAGGAGAAAGGAACAGG + Intergenic
1092339524 12:7663461-7663483 GGGAGGAAGGAGGAAGGGGGTGG + Intronic
1092981393 12:13798158-13798180 CTGAGGAAGGAGAATGGGTCAGG - Intronic
1093138463 12:15479201-15479223 CTAAGGAAGCAAAAAGGGGCTGG - Intronic
1093728794 12:22544584-22544606 CCGAGGAAAGATAAGGGGGCGGG + Intergenic
1094803414 12:34065172-34065194 CCCAGGAAGCACAAGGGGGCAGG + Intergenic
1095465226 12:42482994-42483016 CCGGGGACGCAGAGAGGGGCTGG - Intronic
1095863578 12:46947220-46947242 TGAAGGAAGGAGAAAGGGGAAGG - Intergenic
1095958954 12:47821649-47821671 CAACAGAAGGAGAAAGGGGCTGG - Intronic
1095972192 12:47909959-47909981 CCGAGGAAGAAGACATGAGCTGG - Intronic
1096156956 12:49346290-49346312 CGAAGGAAGGCGCAAGGGGCCGG - Intergenic
1096230099 12:49892022-49892044 CCGAGGAAGGAGATGGGGAAAGG - Intronic
1096263579 12:50107363-50107385 TCGAGGAGGGAGTATGGGGCAGG + Intronic
1096864686 12:54555449-54555471 CAGAGGAAGGCGAAAGAGGTTGG + Intronic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1097740671 12:63238600-63238622 CAAAGGAGGGAGAAAGGGACTGG - Intergenic
1097948875 12:65403865-65403887 CCCAGGAAGCAGAAGGGGTCAGG - Intronic
1097983158 12:65754956-65754978 CTCAGGAGGGAGAAGGGGGCGGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1100391417 12:94148810-94148832 CCCAGGAAGGAGAGCGGGGAGGG - Exonic
1100563796 12:95775393-95775415 CCCAGGAAGCACAAAGGGTCAGG + Intronic
1101533021 12:105591836-105591858 CTGAGGATGGAGGAAGGGCCAGG - Intergenic
1101987734 12:109460809-109460831 CAGAGGGAGGAGGCAGGGGCTGG + Intronic
1102185219 12:110942336-110942358 CCTAGGAAGGATAAAGGGGAGGG - Intergenic
1102458814 12:113087569-113087591 CCTAGAAAGGAGAAAGGGAGAGG + Intronic
1103033856 12:117640681-117640703 CCCAGGGAGGAGGAAGGGGTGGG - Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103841599 12:123869700-123869722 CCTGAGAAGGAGGAAGGGGCTGG - Intronic
1103998956 12:124847991-124848013 CCCAGCAAAGAGAAAAGGGCTGG + Intronic
1104941192 12:132396148-132396170 ACGAGGCAGGAGATGGGGGCCGG - Intergenic
1105513097 13:21067412-21067434 TCCAGGAAGGGGAGAGGGGCTGG + Intergenic
1105828309 13:24142444-24142466 CTGAGGGGGGAGAAATGGGCTGG - Intronic
1106664502 13:31837460-31837482 ACAAGGAAGGAGAAAGTGGAGGG + Intergenic
1107264290 13:38533872-38533894 CAGAAGAAGAAGAAAGGGGGAGG + Intergenic
1108505677 13:51110413-51110435 CCCAGGAAGCAAAAAGGAGCAGG - Intergenic
1108769504 13:53681228-53681250 CCCAGGAAGGAAGAAAGGGCAGG - Intergenic
1108879213 13:55088580-55088602 CAGAGAAAGGAGAAAGGGTTTGG - Intergenic
1108890687 13:55254589-55254611 CCCAGGCAGGAGAAAGGTGCAGG - Intergenic
1109729144 13:66387565-66387587 CGGAGAAAGGAGGAAGGTGCTGG - Intronic
1109991737 13:70067577-70067599 GCCAGGAAGGATAAAAGGGCAGG + Intronic
1110013008 13:70363169-70363191 CTGAGGGATGAGAAAGGAGCTGG - Intergenic
1110857222 13:80310115-80310137 CTCAGGAAGAGGAAAGGGGCTGG - Intergenic
1111760442 13:92457405-92457427 CTGGGGAAGGAGAAGGGTGCTGG - Intronic
1111944282 13:94647495-94647517 CAAAGGAATGAGAAAGGGGATGG + Intergenic
1112487684 13:99834605-99834627 TCGAGGAAGGAAAAAGGAGGAGG - Intronic
1113292668 13:108923519-108923541 GCGAGGAAGGAGAAAGGAGAGGG + Intronic
1113524513 13:110964335-110964357 ACGAAGGAGGAGAAAGGGGGTGG - Intergenic
1113861785 13:113491344-113491366 CCGGGGAGGGAGAGAGGGGAGGG - Intronic
1114344475 14:21780928-21780950 CCAAGGCAGCAGTAAGGGGCTGG - Intergenic
1114516976 14:23306789-23306811 AGGAGGGAGGAGAAAGGGGGGGG - Exonic
1114638775 14:24205116-24205138 TTGAGGAAGGAGGAAGGGTCTGG + Intronic
1115547306 14:34475558-34475580 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1115703899 14:35978532-35978554 CTGAGGCAGGAGAAACAGGCAGG + Intergenic
1116433063 14:44868504-44868526 CATAGGAAGGAGAAAGAGCCAGG + Intergenic
1116489214 14:45486535-45486557 CCCAGGAAGCAGAAGGGGTCGGG - Intergenic
1117172751 14:53117350-53117372 CCCAGGAAGCAGAAAGGGTCAGG + Intronic
1117252004 14:53947701-53947723 GGGAGGATGGAGGAAGGGGCTGG + Intergenic
1117276850 14:54202715-54202737 CCGAGGCAGGAGAATCAGGCAGG - Intergenic
1117459338 14:55929242-55929264 AGGAGGAAGGAGAAAAGGGAAGG + Intergenic
1117495421 14:56297259-56297281 CAGAGGAGGGTGACAGGGGCTGG + Exonic
1118019304 14:61695203-61695225 CGGAGGAAAGAGAAAGGAGATGG - Intergenic
1118516170 14:66530719-66530741 CCCAGGAAGCACAAAGGGTCAGG - Intronic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119603822 14:75997270-75997292 TCAAGGAAGGCCAAAGGGGCTGG - Intronic
1119996836 14:79262458-79262480 AGGAGGAAGGAGAAAGGAGGAGG + Intronic
1119996843 14:79262493-79262515 ATGAGGAAGGAGAAAGGAGGAGG + Intronic
1120382305 14:83796267-83796289 CCGAGGAAGGGTGAAGAGGCAGG - Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1120892724 14:89505371-89505393 CTGAGGCAGGAGAAACAGGCAGG - Intronic
1120945900 14:89996747-89996769 GGGAGTAAGAAGAAAGGGGCAGG + Intronic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121242144 14:92438838-92438860 TCCAGGGAGGAGAGAGGGGCTGG - Intronic
1121483405 14:94295268-94295290 CCGAGGAACCAGGAAGGGGGTGG + Intergenic
1121581507 14:95035643-95035665 CCAAGGAAGGAGGAGGAGGCTGG + Intergenic
1121679747 14:95783649-95783671 CCCAAGATGGAGAAAGGAGCTGG + Intergenic
1121690878 14:95876515-95876537 GCGGGAAAGGAGGAAGGGGCTGG - Intergenic
1122113093 14:99515138-99515160 CAGAGGAAGAAGACAGGGGCTGG + Exonic
1122212150 14:100180385-100180407 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1122233696 14:100320330-100320352 CGGAGGAGGGAGAGATGGGCAGG - Intergenic
1122238058 14:100344179-100344201 CTGAGGCAGGAGAATGAGGCAGG - Intronic
1122917464 14:104865607-104865629 CCGAGGCCGGACAAAGGCGCGGG + Intronic
1124216678 15:27813110-27813132 AGGAACAAGGAGAAAGGGGCAGG + Intronic
1124230917 15:27945508-27945530 CTCAGGAAGGAGGAAGGGTCCGG - Intronic
1124518840 15:30393127-30393149 CAGTTGCAGGAGAAAGGGGCGGG + Intronic
1124920957 15:34025798-34025820 CGGAGGAAGGAGAAAAAGACAGG + Intronic
1125535581 15:40440039-40440061 CGGGGGAGGGAGAAAGGGGCGGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125953443 15:43773584-43773606 CTGCGGCAGGAGAATGGGGCAGG + Intronic
1126336146 15:47588231-47588253 CAGAGGAAGGATAGTGGGGCAGG - Intronic
1127482870 15:59393174-59393196 CCAAGGAAGGTGTAAGGGGACGG + Intronic
1127635609 15:60866608-60866630 TCTAGGGAGGAGAGAGGGGCTGG + Intronic
1128225380 15:65997956-65997978 TCTAGGAAGAAGAAAGGGCCCGG + Intronic
1128683134 15:69665908-69665930 CAGTGGGAGGAGAGAGGGGCTGG + Intergenic
1129148824 15:73673829-73673851 CTAAGGAAGCAGAAAGGGGCAGG - Intergenic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129916954 15:79282686-79282708 GCGAGGAAGGAGGAAGGAGGGGG - Intergenic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130428522 15:83823095-83823117 CTGAGGCAGGAGAATGAGGCAGG + Intronic
1131177240 15:90217744-90217766 CTGGGGAATGAGAAAGGGGAAGG - Intronic
1131439286 15:92446872-92446894 GTGAGCAAGGAGAAAGGGGAAGG + Intronic
1132481790 16:169951-169973 GTGGGGAAGGAGGAAGGGGCTGG + Intergenic
1132482658 16:174208-174230 GTGGGGAAGGAGGAAGGGGCTGG + Intergenic
1132691403 16:1183348-1183370 CCGAGGAAGGAGACGGGCGTGGG + Intronic
1132929894 16:2453725-2453747 CTGAGGAAGGAGACCTGGGCTGG - Intronic
1133177303 16:4025052-4025074 CTGAGGAGGGACAAAGGGGTAGG + Intronic
1133299992 16:4776552-4776574 CCGGGCCAGGAGTAAGGGGCTGG + Intergenic
1133392588 16:5422192-5422214 GGGAGGAAGGAGAAAGGTGGAGG + Intergenic
1133749483 16:8713311-8713333 CCCTGGAAGGAAAAAGGGGAGGG + Exonic
1133998090 16:10762747-10762769 CCGGGACAGGAGAGAGGGGCCGG + Intronic
1134038684 16:11051450-11051472 ACTTGGAAGGAGGAAGGGGCCGG - Intronic
1134045524 16:11098333-11098355 CCGAGGATGCAGAAAGGGACAGG + Intronic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134471971 16:14533305-14533327 CCGAGGCAGGAGAATCAGGCAGG + Intronic
1135186070 16:20316942-20316964 ACGAGGAAGGAGAAGGAGGGAGG - Intronic
1135354380 16:21757307-21757329 ACAAGGAAGGAGAGTGGGGCTGG - Intronic
1135452871 16:22573447-22573469 ACAAGGAAGGAGAGTGGGGCTGG - Intergenic
1135575483 16:23582913-23582935 CCGAGGCAGGAGAATCAGGCAGG - Intronic
1135687679 16:24511292-24511314 AGGAGGAAGAAGAAATGGGCTGG - Intergenic
1135971768 16:27077362-27077384 GGAAGGAAGGAGAAAGGAGCCGG - Intergenic
1136165026 16:28448056-28448078 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1136197939 16:28666924-28666946 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136208057 16:28738437-28738459 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136214286 16:28781101-28781123 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136259006 16:29060946-29060968 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136736602 16:32473156-32473178 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
1136844577 16:33565921-33565943 GCAAGGAAGGAAAAAGGGGGGGG + Intergenic
1137402607 16:48165503-48165525 CCAAGGAAGGGGACTGGGGCAGG - Intergenic
1137617530 16:49856334-49856356 CTGAGGAGGGGGAACGGGGCTGG + Intronic
1137953254 16:52803635-52803657 AGGAGGAAGAAGAAAGGGGAAGG + Intergenic
1137984920 16:53099580-53099602 GGGAGGAAGGAGAAAGCAGCTGG - Intronic
1138124345 16:54426535-54426557 CCAAGGAAGGAGACAGGAGAAGG - Intergenic
1138198987 16:55075048-55075070 CCGGTGAAGGAGCAAGGGGTTGG + Intergenic
1139505277 16:67395405-67395427 TCGAGGCAGGAGAAGGGGGTAGG - Intronic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1139687521 16:68616033-68616055 ACGATGCAGGAGAAAGGGGCAGG - Intergenic
1139915930 16:70428533-70428555 CCTAGCAGGGAGGAAGGGGCAGG - Intronic
1140111686 16:72010164-72010186 ACGAGGCAGGAGAAAGGAGCAGG - Intronic
1140422475 16:74831935-74831957 CCCAGGAAGGAGAAAGTGATTGG + Intergenic
1140846523 16:78893777-78893799 TCGATGAAGGTGAGAGGGGCAGG - Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141683456 16:85556889-85556911 CCGAGGTCGGAGGAGGGGGCCGG + Intergenic
1141692967 16:85606897-85606919 CCGAGGCAGGGGAAGGGGGCTGG - Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1203016466 16_KI270728v1_random:356421-356443 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1203034801 16_KI270728v1_random:629579-629601 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1203154744 16_KI270728v1_random:1866219-1866241 GCAAGGAAGGAAAAAGGGGGGGG + Intergenic
1142640222 17:1281089-1281111 CCCAGGAAGGGGCATGGGGCCGG + Intronic
1142750181 17:1982808-1982830 CAGAGGAAGGAGGAATGGGGTGG + Intronic
1143097637 17:4486875-4486897 GAAAGGAAGGAGAAAGGGGCCGG + Intronic
1143278421 17:5731674-5731696 CCCAGGAAGGATTTAGGGGCAGG + Intergenic
1144070196 17:11664591-11664613 CTGAGGAAGGAGGATGGGGTTGG - Intronic
1144784796 17:17825492-17825514 CCGAGGAAGGGGGAAGGGCCTGG + Intronic
1145026936 17:19475455-19475477 CTGAGGAAGGAGAATCAGGCAGG - Intergenic
1146287024 17:31581098-31581120 GGCAGGAAGGAGAGAGGGGCAGG - Intergenic
1146726659 17:35161823-35161845 TCCAGGAAGGGGAGAGGGGCTGG + Intronic
1147000543 17:37359168-37359190 CTGAGGTGGGAGACAGGGGCGGG - Intronic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147212146 17:38877886-38877908 ATGAGGAAGGAGAGAGGGGAGGG + Intronic
1147310272 17:39592017-39592039 CACAGGATGGAAAAAGGGGCTGG + Intergenic
1147326370 17:39671653-39671675 CAGAGGAAGGAAAATGGGGATGG - Exonic
1147441958 17:40452893-40452915 CCCAGGAAGGAGAACGTGGGTGG + Intronic
1147581948 17:41631984-41632006 CCGAGCAAGGAGATGGGGGCTGG - Intergenic
1147775511 17:42898097-42898119 TGGAGGAAGCAGAAAGGGGCTGG + Intergenic
1147914566 17:43878776-43878798 CATAGGAAGGAGGATGGGGCTGG + Intronic
1148145550 17:45362417-45362439 CTGAGGGAGGAGGGAGGGGCTGG - Intergenic
1148188333 17:45660779-45660801 TGGGGGAAAGAGAAAGGGGCGGG - Intergenic
1148390104 17:47265954-47265976 CCAAGGAAGGAGAAGGAGACAGG - Intronic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1148806921 17:50268588-50268610 CCCAAGAATGAGAAAGGGGCTGG + Intergenic
1149466558 17:56884465-56884487 CCAAGACAGGAGAAAGGGGTTGG + Intergenic
1150577575 17:66443732-66443754 CAGAGGATGGAGGAAAGGGCAGG + Intronic
1151789858 17:76298275-76298297 CTGAGGCAGGAGAATGGCGCCGG - Intronic
1151884584 17:76916097-76916119 CCGAGGAAGGATGAAGGGCAGGG - Intronic
1152019953 17:77775761-77775783 CCGAGGCAGGAGAATCAGGCAGG - Intergenic
1152128691 17:78462826-78462848 CCCAGGTAGGAGAGGGGGGCTGG - Exonic
1152396643 17:80036906-80036928 CCGAGAGAGGACAAAGGGACAGG - Intronic
1152524428 17:80879420-80879442 GAGTGGGAGGAGAAAGGGGCAGG - Intronic
1152526967 17:80893875-80893897 CCTCGGAAGCAGAAAGGGGCAGG - Intronic
1153268449 18:3295368-3295390 CCCAGGAAGGAGCAGGGGGCTGG + Intergenic
1154357136 18:13630278-13630300 CCCAGGAGGAAGAAAGGGGGAGG + Intronic
1155219486 18:23671416-23671438 CCCAGCAAGTAGAATGGGGCTGG + Intergenic
1155326163 18:24666963-24666985 GAGAGGAAAGAGAAAGGGGAAGG - Intergenic
1156196609 18:34781120-34781142 CAGGGGCAGGAGAAAGAGGCAGG + Intronic
1156213006 18:34967432-34967454 TCCAGGAAGGAGAAAGGGCCTGG - Intergenic
1156336563 18:36178115-36178137 CCGAGGAGGGAGAAACAGGAAGG - Intronic
1156626015 18:38909920-38909942 CGAAGGAAGGGGAAAGAGGCAGG + Intergenic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1157470281 18:47983160-47983182 AGGAGGAAGGGGAAAGGGGAAGG - Intergenic
1157816033 18:50729934-50729956 CCAAGGCAGCAGAGAGGGGCGGG - Exonic
1158032398 18:52982170-52982192 CAGAGGGAGGATAGAGGGGCAGG + Intronic
1158429239 18:57369353-57369375 CAGAGGAAGGAGAACTGGACAGG - Intronic
1158488975 18:57893172-57893194 TCTGGGAAGGAGCAAGGGGCTGG + Intergenic
1159134265 18:64318638-64318660 GAGAGGAAGGAGAAAGAGGGAGG - Intergenic
1159798194 18:72868081-72868103 GGGAGGGAGGAGAAAGGAGCCGG + Intronic
1159925836 18:74268408-74268430 CCAGGGTAGGAGAAAGGGCCAGG + Intronic
1160097599 18:75889701-75889723 CCAAAGAAGGAGAGAGGGTCAGG - Intergenic
1160281673 18:77496607-77496629 CAGAGGAAGTAGGAAGGAGCTGG - Intergenic
1160473038 18:79156248-79156270 AAGAGGAAAGAGAAATGGGCTGG - Intronic
1161803547 19:6429514-6429536 AGGAGGAAGGAGAAAGGAGGAGG + Intronic
1161810322 19:6467692-6467714 CTGAGGAAGGATCAAGGGGCTGG + Exonic
1162278066 19:9674092-9674114 TCGGGGAAGGACAAAGCGGCAGG - Intronic
1162524009 19:11197194-11197216 CCAAGACAGGAGAAACGGGCAGG + Intronic
1162602276 19:11677775-11677797 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1163144963 19:15373824-15373846 CCAAGGAAGGAGGCAGGGGCGGG - Exonic
1163755839 19:19105771-19105793 CAGAAGAAAGAGAGAGGGGCGGG - Intronic
1164231343 19:23290707-23290729 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1164301009 19:23963500-23963522 CTGAGGCAGGAGAACGAGGCAGG - Intergenic
1164735214 19:30536179-30536201 CCAAGGATGAAGAAGGGGGCAGG - Intronic
1165116715 19:33533252-33533274 ACCAGGAAGGAGGAGGGGGCTGG - Intergenic
1165363936 19:35352465-35352487 CGGGGGAAGGAGCATGGGGCAGG + Exonic
1166193802 19:41193530-41193552 CCTAGGGAGGAGGCAGGGGCAGG + Intronic
1166391463 19:42411057-42411079 CCGAGGAGGGACAAAGGCACTGG - Intronic
1166956378 19:46468186-46468208 CCGAGGAGGGAGCAAGGCGTGGG + Exonic
1167671719 19:50857348-50857370 AGGAGGAAGGAGAAGGGGGAAGG + Intronic
1167694817 19:51009248-51009270 CCGAGTAAGGTGGAAGAGGCCGG + Exonic
1167723079 19:51192264-51192286 CTCAGGAAGGAGGGAGGGGCTGG + Intergenic
1167887761 19:52516147-52516169 CTGAAGGAGGAGAAAGGGACAGG - Intergenic
1167937661 19:52921090-52921112 CTGAAGGAGGAGAAAGGGACAGG + Intergenic
1167964045 19:53129083-53129105 CCGAAGGAGGAAAAAGGGACAGG + Intronic
1168155463 19:54471650-54471672 CGGAGGAAGAAGGAAGGCGCGGG - Exonic
925172024 2:1755750-1755772 AAAAGGAAGGAGAAAGGGGCTGG - Intergenic
925287817 2:2727323-2727345 GGGAGGAAGGAGACAGGGCCAGG - Intergenic
925326927 2:3030084-3030106 CAGAGGGAGAAGAAAGAGGCAGG + Intergenic
925347317 2:3179992-3180014 CCGGGGAAGGAGGAAGAGACAGG - Intergenic
925350054 2:3194717-3194739 CCATGGAAGCAGGAAGGGGCCGG + Intronic
925789828 2:7472698-7472720 CCGAGGGAGTAGAATGAGGCTGG + Intergenic
926003882 2:9356508-9356530 CCGCGGCAGGGGAGAGGGGCGGG + Intronic
926169057 2:10539570-10539592 TCCAGGAAGGAGAGAGGGGCTGG + Intergenic
926233221 2:11020458-11020480 GCGAAGGAGTAGAAAGGGGCGGG - Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
927111749 2:19868862-19868884 CCTAGGCAGGAGAAGCGGGCGGG - Intergenic
927148488 2:20182085-20182107 CCGAGGAAGGAGGTGGGGACAGG + Intergenic
927152926 2:20205956-20205978 CCGAGGACGGCACAAGGGGCAGG + Intronic
927315462 2:21676118-21676140 TCCAGGAAGGAGAGAGGGGCTGG + Intergenic
927631545 2:24778472-24778494 AGGAGGAAAGAGAAAGGGGGAGG + Intergenic
927706257 2:25298277-25298299 CCGAGTGAGGGGAGAGGGGCCGG - Intronic
928518203 2:32063656-32063678 CCGAGGAAGGAGAAAGGGGCGGG + Exonic
929340967 2:40816959-40816981 CCAAGGAGGGCGAAAGGGGCAGG - Intergenic
929431740 2:41893198-41893220 CCGGGGAGGGAGGAAGGGGAAGG - Intergenic
929520383 2:42644869-42644891 CCCAGGAGAGAGAAAGAGGCAGG - Intronic
929557762 2:42936245-42936267 GCCAGGAAGGAGAAACGGACTGG - Intergenic
929823634 2:45292916-45292938 ATGAGGAAGGAGCAAGGGTCAGG - Intergenic
930136144 2:47905782-47905804 TCGGGGCAGGAGAAAGGGGTGGG + Exonic
930632315 2:53767492-53767514 CCGAGGAAGGAGAAAAGAGCAGG - Intronic
931340771 2:61398579-61398601 CGGGGGAGGGAGAAAGGGGAGGG + Intronic
931752334 2:65341028-65341050 CTAAGGAGAGAGAAAGGGGCGGG + Intronic
931868954 2:66439458-66439480 CCGGTGGAGGAGAAAGGCGCCGG - Intronic
932168965 2:69536208-69536230 AGGAGGAAGGAGAAAGGGAGAGG + Intronic
932355419 2:71064549-71064571 ATGAGGAAGGAGAGAGAGGCTGG - Intronic
932491942 2:72127993-72128015 CCCAGGGTGGGGAAAGGGGCAGG - Intergenic
933943139 2:87261961-87261983 CTGAGGAAGGAGAACGTGCCGGG - Intergenic
934187756 2:89762273-89762295 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
934308861 2:91845675-91845697 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
934657337 2:96123118-96123140 CCTTGGAAGGAGAAAGGGCTGGG - Intergenic
935112146 2:100104240-100104262 CCGGGGAGGCAGAAAAGGGCTGG + Intronic
935190562 2:100774919-100774941 CCCAGGAGAGAGAAAGTGGCTGG + Intergenic
935354728 2:102187668-102187690 CAGACGAAGGAGACAGGGGAAGG + Intronic
935914168 2:107931332-107931354 CTGAGGCAGGAGAAAATGGCAGG - Intergenic
936122829 2:109760911-109760933 CCGGGGAGGCAGAAAAGGGCTGG - Intergenic
936221860 2:110610553-110610575 CCGGGGAGGCAGAAAAGGGCTGG + Intergenic
936263328 2:110980449-110980471 CCAAGAAGGGAGAAAGGGACTGG + Intronic
936327924 2:111521768-111521790 CGGAGGCAAGAGTAAGGGGCTGG + Intergenic
936337073 2:111599602-111599624 CTGAGGAAGGAGAACGTGCCGGG + Intergenic
936442363 2:112565813-112565835 TCCAGGAAGGGGATAGGGGCTGG - Intronic
936557939 2:113512096-113512118 CCCAGGGAGGGGAGAGGGGCTGG + Intergenic
937110583 2:119364063-119364085 CAGAGATAGGAGAAAGGGGGAGG + Intronic
938120725 2:128631354-128631376 CTCAGGAAGGAGAGTGGGGCAGG + Intergenic
938719818 2:134056669-134056691 CAGAGGAAGGAGAAAAAGACAGG + Intergenic
938954243 2:136283408-136283430 TGGTGGAAGGAGAAATGGGCAGG + Intergenic
939629541 2:144516486-144516508 AGGAGGAAGGAGAAAGGAGATGG - Intronic
940135014 2:150425797-150425819 CAGAGGAAGGAAACTGGGGCAGG - Intergenic
940160581 2:150708331-150708353 GTGAGGCAGGAGAAAGGGGAGGG + Intergenic
940298989 2:152159825-152159847 CTGAGGCAGGAGAATGAGGCAGG - Intronic
940640586 2:156341774-156341796 CCGGGGGAGGAGAAAAAGGCGGG + Intronic
941905378 2:170713928-170713950 GCGGGGAAGGAGGAAGAGGCGGG - Exonic
942113034 2:172700902-172700924 CCGAGGCAGGAGAATCAGGCAGG + Intergenic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942292653 2:174487299-174487321 CCGAGGCTGGAGGAGGGGGCGGG - Intergenic
942552805 2:177137362-177137384 CAGAAGATGGGGAAAGGGGCTGG - Intergenic
942863683 2:180646930-180646952 TCCAAGAAGAAGAAAGGGGCAGG + Intergenic
942945476 2:181667539-181667561 TTGAGGGAGGGGAAAGGGGCTGG + Intronic
943605951 2:189976906-189976928 CCCAGGAAGCACAAAGGGTCAGG - Intronic
944553932 2:200869537-200869559 CCAAAAAAGGAGGAAGGGGCAGG + Intergenic
946024776 2:216665229-216665251 CCGAGGAAGGTTAGGGGGGCAGG - Intergenic
946313889 2:218897288-218897310 CCGAGGCAGCAGAAAGGGGAGGG + Intronic
946854724 2:223941410-223941432 CAGAGGAAGGAGGAAAGGACAGG - Intronic
947142145 2:227029288-227029310 AAGAGGAAGGAGGAAGGGGCTGG - Intronic
948078989 2:235190079-235190101 CCGAAGGAGGAGATGGGGGCAGG - Intergenic
948567491 2:238896141-238896163 CGGAGGGGGGAGAGAGGGGCGGG + Intronic
948625299 2:239264832-239264854 CCGAGTAGGAAGGAAGGGGCAGG - Intronic
948806652 2:240456046-240456068 CCGAGGAGGGAGGGAGGGACGGG + Intronic
1168854770 20:1001004-1001026 CTGAGCAAGGATAAAGGGGAAGG - Intronic
1169118828 20:3083533-3083555 AGGAGGAAGGAGGAAGGGTCTGG - Intronic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1169187363 20:3630014-3630036 TCCAAGAAGGGGAAAGGGGCTGG - Intronic
1170757852 20:19220433-19220455 CAGAGGACAGAGAAAGGAGCAGG + Intronic
1171173524 20:23035185-23035207 CCGAGGTGGGAAAACGGGGCGGG + Intergenic
1171997085 20:31739760-31739782 CTGAGGAAGGAGGAAGGAGGAGG + Intronic
1172093335 20:32448505-32448527 CAGTGGATGGAGGAAGGGGCTGG + Intronic
1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG + Intergenic
1172623937 20:36336847-36336869 CCCAGGAAGGAGAAGGGGGCTGG - Intronic
1173114719 20:40230295-40230317 GAGAGCAAAGAGAAAGGGGCAGG + Intergenic
1173137124 20:40448153-40448175 CTGAGGAAGGAGAAAATGTCAGG + Intergenic
1173769744 20:45646677-45646699 CCGAGGCAGGAGAATCAGGCAGG + Intergenic
1175452061 20:59077765-59077787 AGGAGGAAGGAGAAAGGAGAAGG + Intergenic
1175777699 20:61663527-61663549 CGGAGGAAGGTGAACAGGGCAGG + Intronic
1176048246 20:63103442-63103464 GGGAGGAAGGAGGAAGGAGCGGG + Intergenic
1176090536 20:63316482-63316504 CAGGGGAGGGAGGAAGGGGCAGG - Intronic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1178752745 21:35319908-35319930 CCGAGGCAGGAGAAGTGGGGAGG - Intronic
1178877196 21:36422466-36422488 CCCGGGAAGGAGACAGGGACAGG - Intergenic
1179085023 21:38208224-38208246 CCCAGGAAGCAGGAAGGAGCAGG - Intronic
1179929397 21:44557510-44557532 CAGAGGAAGGAGAGAGGGGGAGG + Intronic
1180188504 21:46151828-46151850 CCCAGCCAGGACAAAGGGGCAGG + Intronic
1180217973 21:46338299-46338321 CTGGGGAAGGAGAGAGCGGCTGG - Intronic
1180535944 22:16392763-16392785 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1181296830 22:21847096-21847118 CTGAGGCAGGAGAAACAGGCAGG - Intronic
1182212823 22:28690811-28690833 GCAAGGAAGGAAAAAGGGGAGGG + Intronic
1183309395 22:37101282-37101304 CTGAAGCAGGAGACAGGGGCAGG + Intronic
1183604434 22:38860349-38860371 CCGAGGGAGGAGACAGGGCAGGG + Intergenic
1183606002 22:38866985-38867007 CCGAGAAGGGCGAAATGGGCGGG + Exonic
1183771579 22:39930938-39930960 CCTAGGACGGAGACAGGTGCAGG - Intronic
1183777295 22:39974916-39974938 CTGAGGAGGGAGGCAGGGGCCGG - Intergenic
1183778819 22:39985410-39985432 CCGAAGAAGGAGAAAGGTGCAGG - Intergenic
1183783066 22:40011080-40011102 CTGTGGAAGGAGAAAGGAGTGGG - Intronic
1184120076 22:42444466-42444488 CCCAGGGGTGAGAAAGGGGCTGG - Intergenic
1184189553 22:42885743-42885765 CCAGGAGAGGAGAAAGGGGCAGG - Intronic
1184265117 22:43342610-43342632 CCGGGGAAGGAGGAGGAGGCCGG - Intronic
1184275060 22:43405296-43405318 CCGATGCAGGAGTAAGGGACAGG + Intergenic
1184797012 22:46738389-46738411 AAGAGGGAGGAGGAAGGGGCCGG + Intergenic
1184950670 22:47840529-47840551 CTGGGGAGGCAGAAAGGGGCAGG - Intergenic
1185045136 22:48524950-48524972 AAGAGGCAGGAGAAAGGGCCAGG - Intronic
949641108 3:6036646-6036668 CCCAGGAAGCACAAGGGGGCAGG - Intergenic
949942727 3:9167147-9167169 CCTGGGCAGGAGAAAGGGGGAGG + Intronic
950218794 3:11178749-11178771 CGGAGAAAGCAGAAAGGGTCTGG - Intronic
951194137 3:19804704-19804726 CCTAGGAAGGGGGAAGGGGGAGG + Intergenic
952245031 3:31578683-31578705 GCATGGAAGGAGAAAGGGGGAGG - Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952455556 3:33468369-33468391 CCTACCAAGGAGAATGGGGCAGG - Intergenic
953534838 3:43769735-43769757 CCAAGGAAGGCGGAAGGAGCCGG - Intergenic
954762759 3:52888926-52888948 ACGAGGAAGGAGGGAGAGGCTGG - Intronic
956345245 3:68271128-68271150 GAGAGGAAGGGGGAAGGGGCAGG - Intronic
956458053 3:69443157-69443179 CCCAGGGAGGGGAGAGGGGCTGG + Intronic
956553012 3:70482958-70482980 CTGGAGAATGAGAAAGGGGCTGG + Intergenic
956755312 3:72380357-72380379 CCCAGGATGGAGAAAGGGACTGG + Intronic
957825038 3:85430592-85430614 GCGAATAAGGAGAAAGGGGGCGG + Intronic
958162195 3:89831912-89831934 CCCAGGAAGGACAAGGGGTCAGG + Intergenic
959395954 3:105838516-105838538 GAAAGGGAGGAGAAAGGGGCAGG + Intronic
960247156 3:115412476-115412498 CAAAGGAAGGACAATGGGGCTGG - Intergenic
960378547 3:116932432-116932454 TCCAGGCAGGAGAAAGGGACAGG - Intronic
960391380 3:117081459-117081481 TGGAGGAAGGAGAAATGGTCTGG - Intronic
960920844 3:122746749-122746771 CCGAGGCAGGAGAATCAGGCAGG - Intronic
961169153 3:124783981-124784003 CCGATGAAGGACAAAGGGTGAGG - Intronic
961714199 3:128847575-128847597 GGGAGGAAGGGGAAGGGGGCAGG + Intergenic
962345179 3:134613418-134613440 AGGAGGAAGAAGCAAGGGGCAGG + Intronic
962940001 3:140117109-140117131 CTGAGGAATGAGAAAGCAGCAGG - Intronic
963788754 3:149561860-149561882 CCTGGAAAGGAGAAAAGGGCTGG + Intronic
963880522 3:150523511-150523533 GCGAGGAAGGATAAGGGGGCAGG + Intergenic
964877549 3:161385457-161385479 ACTAGGAGGGAGAAAGGGGAAGG + Intergenic
966905890 3:184525700-184525722 CCTGGGAAAGAGAAAGCGGCCGG - Intronic
968573683 4:1355223-1355245 CTGAGGGAGGGGAAAGGCGCAGG + Exonic
968908662 4:3465906-3465928 GGGAGGAAGAAGAGAGGGGCTGG - Intronic
968938138 4:3624317-3624339 AGGAGGAAGGAGAAAGGAGCAGG + Intergenic
969232224 4:5839757-5839779 CTGTGGAGGGAGAACGGGGCTGG + Intronic
969564583 4:7970514-7970536 CTGGGGAAGGAGAGAAGGGCAGG + Intronic
970405533 4:15759596-15759618 ATGAGGAAGAAGAAAGGGGATGG - Intergenic
972123521 4:35735575-35735597 GAAAGGAAGGAGAAATGGGCTGG + Intergenic
972396973 4:38665164-38665186 CCGGGGCAGGAGAAATGAGCTGG + Intronic
972769110 4:42179746-42179768 CTGAGGCAGGAGATAGGGTCTGG - Intergenic
973570506 4:52234185-52234207 GAAGGGAAGGAGAAAGGGGCAGG - Intergenic
974092095 4:57322104-57322126 CCAAGAAAGGAGAAAGAAGCTGG - Intergenic
974882204 4:67773813-67773835 CTGAGGAAGGAGAATGGCCCTGG - Intergenic
976618405 4:87101624-87101646 ACAAGGCAGGAGAAAGAGGCTGG - Intronic
976660036 4:87531107-87531129 CGGAGGAAGGATAAAGGGGTGGG + Intergenic
980060937 4:128128866-128128888 CTGATGAAAGAAAAAGGGGCTGG + Intronic
981086545 4:140689662-140689684 GGGAGGAAGGAGAAAGGGGAGGG - Intronic
982132752 4:152245043-152245065 GCAAGTAAGTAGAAAGGGGCAGG + Intergenic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
982257733 4:153466612-153466634 GGGAGGAAAGGGAAAGGGGCAGG + Intronic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982820207 4:159934999-159935021 CCCAGGAAGCACAAAGGGTCAGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984860362 4:184232311-184232333 TCCAGGGAGGGGAAAGGGGCTGG - Intergenic
985658210 5:1142919-1142941 CCCAGGATGGAGAATGGGCCAGG - Intergenic
985727647 5:1524255-1524277 GCGGGGAGGGAGGAAGGGGCGGG + Intergenic
986254590 5:6091621-6091643 CAGAGAAAGGAGGAAGGGACAGG + Intergenic
986626558 5:9728490-9728512 TCAAGGTAGGAGAAAGGGTCAGG + Intergenic
986773501 5:10994339-10994361 CCGGGGAAGGAGGAGGGGGGCGG + Intronic
986773509 5:10994358-10994380 GCGGGGAAGGAGGAAGGGGCCGG + Intronic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
987231319 5:15896595-15896617 CAGAGGAAGGAGGAACTGGCAGG - Intronic
987469142 5:18309080-18309102 CCGAGGCAGGAGAATCAGGCAGG - Intergenic
989128381 5:38079209-38079231 CCCATGAAGGAGGCAGGGGCTGG - Intergenic
989467650 5:41775623-41775645 TCTAGGAAGGAGAGAGGGTCTGG - Intronic
989666453 5:43859680-43859702 CCTGGGAAGGATAAAGGGGCTGG + Intergenic
991236627 5:64406844-64406866 CCTGGGAAGCAGAAAGGGTCAGG + Intergenic
992378224 5:76210673-76210695 TCCAGGAAGGGGAGAGGGGCTGG - Intronic
993418886 5:87674875-87674897 AGGAGAAAGGAGAAAGGAGCAGG - Intergenic
995600457 5:113790168-113790190 CCAAGCAAAGAGAATGGGGCTGG + Intergenic
995692623 5:114844610-114844632 CCCAGGAAGCAGAAGGGGTCAGG + Intergenic
996642988 5:125779900-125779922 AGTAGGAAGGATAAAGGGGCAGG - Intergenic
997302962 5:132819813-132819835 GCCAGGAAGGAGGATGGGGCAGG + Intergenic
997771750 5:136561486-136561508 CTGAGGAAGAAGACAGGGGCAGG - Intergenic
997875120 5:137538978-137539000 CTGAGGCAGGAGAATGAGGCAGG + Intronic
998172906 5:139882899-139882921 CTGAGGAACAAGAAAGAGGCAGG + Intronic
998475350 5:142416675-142416697 CCTAGGAAGGTGAAAGCAGCAGG + Intergenic
999319338 5:150603724-150603746 CAGAGGAAGGAGCACAGGGCTGG + Intronic
999369872 5:151048179-151048201 CCGGGGAAGGAGGAAGAGGGTGG + Intronic
999436941 5:151570579-151570601 CCAAGGATGGGGCAAGGGGCAGG + Intergenic
999945664 5:156592573-156592595 TCTAGGAAGGAGAAGGGAGCTGG - Intronic
1000047116 5:157530883-157530905 CCTAGCAAGGAGAAAGGAGGTGG + Exonic
1000198654 5:158986128-158986150 GCTGGGAAGGAGACAGGGGCTGG - Intronic
1000379302 5:160614669-160614691 CTGAGGAGGGAGAATGGGGTTGG - Intronic
1001884819 5:175279921-175279943 CCTAGGAAGGAGGAAAGGTCAGG + Intergenic
1001947962 5:175796515-175796537 CCGAGAAAGGAGGCGGGGGCTGG - Exonic
1002257897 5:177972442-177972464 CTGAGGAAGTTGGAAGGGGCTGG - Intergenic
1002689727 5:181042342-181042364 CTGGGGAAGGAGTAAGGGACTGG - Intronic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1002761938 6:209185-209207 CCTAGGAAGAAGAAAGGGGAAGG + Intergenic
1002924052 6:1594710-1594732 CCAAGGGAGGAGGGAGGGGCAGG + Intergenic
1003109611 6:3242528-3242550 CATAAGAAGGAGAAAGGGTCAGG - Intronic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1004098769 6:12586696-12586718 CAGAGGAAAAACAAAGGGGCAGG - Intergenic
1004350874 6:14889287-14889309 CTGAGGCAGGAGGATGGGGCAGG - Intergenic
1005459440 6:26054531-26054553 CCCAAGAAAGAGAAAGGGGAGGG - Intergenic
1005865198 6:29932160-29932182 CTGAGGCAGGAGAATCGGGCAGG - Intergenic
1005997580 6:30940756-30940778 CAGAGGAACCAGAAAGGAGCAGG - Intergenic
1006175782 6:32120745-32120767 CTGAAGAAGGAGAAAAGGGCCGG - Intronic
1006403983 6:33833445-33833467 CCGAGGCAGGAGAATCAGGCAGG + Intergenic
1006682198 6:35805326-35805348 CCGCGGACGGAGGAGGGGGCGGG + Exonic
1006706589 6:36026304-36026326 TCGAGTAAGGAGAATAGGGCAGG - Intergenic
1007009194 6:38398558-38398580 CAGAGGATGGCGAAAGGGCCTGG - Intronic
1007392849 6:41560584-41560606 CGGGGGAGGGAGAGAGGGGCGGG - Intronic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1007765578 6:44157930-44157952 CCCAGAAAGGAGAAAGGGGGAGG + Intergenic
1007967564 6:46016106-46016128 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967574 6:46016131-46016153 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967584 6:46016156-46016178 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967594 6:46016181-46016203 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967604 6:46016206-46016228 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1008841761 6:55910886-55910908 CCGAGGCAGGAGAATCAGGCAGG + Intergenic
1010006157 6:70997874-70997896 CCCAGGAAGTACAAAGGGTCAGG + Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010454803 6:76042717-76042739 GAGAGGAAGGATAAAGGGGGAGG + Intronic
1010461454 6:76118695-76118717 CCCAGGAAGCAGAAGGGGTCAGG - Intergenic
1010469130 6:76205088-76205110 TCAAGGCAGGAGACAGGGGCTGG - Intergenic
1013680589 6:112521457-112521479 CCCAAGGAGGAGAAAGGGGCTGG - Intergenic
1015211946 6:130708617-130708639 GAGAGGAAGGAAGAAGGGGCAGG + Intergenic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG + Intergenic
1017056079 6:150436496-150436518 CTGAGCAACTAGAAAGGGGCTGG - Intergenic
1017851679 6:158309788-158309810 CCGAGGCAGGAGAATCAGGCAGG + Intronic
1018652779 6:166005771-166005793 CCGAGGAAGGAGGTAGGGCTGGG - Intergenic
1018690335 6:166339301-166339323 TCTAGGGAGGAGGAAGGGGCAGG - Intronic
1018740542 6:166725479-166725501 CGGAGGCTGGAGAAAGAGGCTGG - Intronic
1019023191 6:168936245-168936267 CCAAGGAAGGAGAAAGGAAGAGG + Intergenic
1019174187 6:170151713-170151735 CAGCAGAAGGAGACAGGGGCAGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019906048 7:4066183-4066205 GCCAGGGAGGAGAAAAGGGCAGG - Intronic
1019969144 7:4526137-4526159 AAGAGGAAGAAGAAAGGGGAAGG + Intergenic
1020285061 7:6672328-6672350 CTGAGGCAGGAGAATTGGGCAGG + Intergenic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1021655688 7:22871299-22871321 TGGAGGGAGGACAAAGGGGCAGG + Intergenic
1021845240 7:24757249-24757271 CCTAGGAAGGAGCGAGGGGAGGG + Intronic
1021846724 7:24770123-24770145 CCCAGGGAGGGAAAAGGGGCTGG + Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025107026 7:56179830-56179852 CTGAGGCAGGAGAAAGTGGCAGG + Intergenic
1026311188 7:69186085-69186107 CTGAGGCAGGGGAAAGTGGCAGG - Intergenic
1026603059 7:71792612-71792634 CCCAGGAAGGAAAAAGGAGGTGG + Intronic
1026965159 7:74434764-74434786 CCCAGGAAGGTGAGTGGGGCTGG + Intergenic
1027132246 7:75599325-75599347 CTGGAGGAGGAGAAAGGGGCGGG - Intronic
1027219511 7:76204956-76204978 CTGAGTGAGGAGAAAGGAGCTGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1029459682 7:100687617-100687639 CTGAGGAGGGAGCCAGGGGCGGG + Intronic
1029549672 7:101231046-101231068 GAGATGAAGGAGAAAGGGGAGGG + Intergenic
1029866898 7:103641790-103641812 CCAAGGAACAAGAAAGGGGCTGG + Intronic
1030107695 7:106000382-106000404 CAGAGGAAGGAGAAATGGCAGGG - Intronic
1030115356 7:106058691-106058713 CCGAGGAGGGAGGACAGGGCGGG - Intergenic
1030766014 7:113410617-113410639 GGGAGGAAGGAGAAATTGGCTGG + Intergenic
1032542507 7:132715042-132715064 CCGTGGCAGGAGAAAGGGCTGGG - Intronic
1033478666 7:141716378-141716400 GTGAGGAAGGAGAAAAGGGAGGG - Intronic
1033592275 7:142819715-142819737 CCCAGGGAGGAGAAAGCGGTGGG + Intergenic
1035022666 7:155808572-155808594 CGGAGGAGGGCGCAAGGGGCGGG - Intronic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035174011 7:157037699-157037721 GGGAGGCAGGAGAAAGGGGAGGG + Intergenic
1035185793 7:157125195-157125217 CCGAGGAAGGAGGAAGCCTCTGG + Intergenic
1035993890 8:4523859-4523881 CCAAAGAAGGAGAAAGGAGTTGG - Intronic
1036009412 8:4704760-4704782 TCGAGGCAGGAGAAAGGGAGTGG + Intronic
1036295957 8:7537433-7537455 CAGAGGAAGGAGTATGTGGCCGG + Intergenic
1036326609 8:7783586-7783608 CAGAGGAAGGAGTATGTGGCCGG - Intergenic
1037769141 8:21788930-21788952 CCGCGAAGGGAGAAGGGGGCGGG - Intronic
1038644345 8:29350335-29350357 CCTAGGCTGCAGAAAGGGGCGGG + Exonic
1039754903 8:40512693-40512715 CCCAGGAAGCACAAAGGGTCAGG - Intergenic
1039902368 8:41762197-41762219 CCCAGGGAGGAGGAAGGTGCAGG - Intronic
1040079903 8:43275482-43275504 CCGAGGAGGGAAGAAGGAGCAGG - Intergenic
1040431776 8:47349906-47349928 CCCAGGAAGCACAAAGGGTCAGG - Intronic
1041107500 8:54457781-54457803 CCGGGGGAGGGGCAAGGGGCGGG + Intergenic
1042030366 8:64469560-64469582 CAGAGGAAGGAGAAAGGTAGAGG - Intergenic
1043342978 8:79263948-79263970 CTGAGGAAGGAGAACGCGGGAGG + Intergenic
1043508445 8:80925661-80925683 GGGGGGAAGGAGAAAGTGGCTGG - Intergenic
1044803010 8:95976365-95976387 CTGAGACAGGTGAAAGGGGCTGG - Intergenic
1046682864 8:117191634-117191656 CCCAGGAAGCACAAAGGGTCAGG + Intergenic
1046754059 8:117955306-117955328 TCCAGGGAGGAGAGAGGGGCTGG - Intronic
1046885681 8:119364408-119364430 CTGAGAAAGGGGAAAGGGGGAGG - Intergenic
1046927681 8:119809696-119809718 CCGAGGAAGGGGACAGAGACAGG + Intronic
1047316640 8:123740973-123740995 CTGAGGAAGGAGAAAAGGAGGGG - Intergenic
1047357904 8:124140760-124140782 CACAGGAAGGAGGAAGGGCCAGG + Intergenic
1047410663 8:124621843-124621865 CTGGGGAAAGAGATAGGGGCTGG - Intronic
1048354588 8:133642794-133642816 CTGTGGAAGGCGGAAGGGGCTGG + Intergenic
1048516562 8:135116765-135116787 GAGAAGAAGGAGAAAGGAGCCGG - Intergenic
1049181790 8:141226655-141226677 CCGAGGATGGAGAGACAGGCCGG + Intronic
1049183474 8:141235635-141235657 CGGAAGAGGGAGAGAGGGGCAGG + Intronic
1049235649 8:141510936-141510958 CCCAGGCAGGAGAAGGGGGCTGG + Intergenic
1049422518 8:142523253-142523275 CCGGGTAGGGAGAAAGGGTCTGG + Intronic
1049841730 8:144777577-144777599 CCTGGGAAGGAGACAGGGACTGG + Exonic
1050562222 9:6845708-6845730 GCATGAAAGGAGAAAGGGGCCGG + Intronic
1051562891 9:18462640-18462662 TAGAAGAAGGAAAAAGGGGCCGG + Intergenic
1051640905 9:19223774-19223796 CAGAGAAAGGAGTAATGGGCAGG - Intergenic
1052219135 9:25998351-25998373 CCAAGGATGGAGAGAGAGGCAGG - Intergenic
1052499390 9:29270403-29270425 CCCAGGAAGCACAAAGGGTCAGG + Intergenic
1052806418 9:33017840-33017862 TCCAGGGAGGAGAAAGGGGCTGG - Intronic
1052928541 9:34038379-34038401 CCGAGGCAGGAGAATCAGGCAGG - Intronic
1052941760 9:34136935-34136957 CCGAGGCAGGAGAATCAGGCAGG - Intergenic
1053020311 9:34689892-34689914 CAGAGGGAGGAGACAGGGCCAGG + Intronic
1053347426 9:37388169-37388191 CTGAGGCAGGAGAAAGGTGGAGG - Intergenic
1053519435 9:38763200-38763222 CCAAGCAAGGAGAATTGGGCAGG - Intergenic
1053737118 9:41108678-41108700 CCGAGGGAGGGGAGAGGGGCTGG - Intergenic
1054453033 9:65413389-65413411 AGGAGGAAGGAGAAAGGAGCAGG - Intergenic
1054691229 9:68322639-68322661 CCCAGGGAGGGGAGAGGGGCTGG + Intergenic
1054707972 9:68482281-68482303 CCAACCAAGGAGAAAGGGGCAGG - Intronic
1055685974 9:78775271-78775293 AGGAGGAAGGAGAGACGGGCAGG - Intergenic
1056565756 9:87771311-87771333 CCGAGGCAGGAGTTGGGGGCGGG - Intergenic
1056736585 9:89214999-89215021 GTGAGGATGGAGAAAGGGACAGG + Intergenic
1057555069 9:96081575-96081597 GAGAGGAAGGATAAGGGGGCAGG - Intergenic
1058164468 9:101604651-101604673 GGTAGGAATGAGAAAGGGGCAGG + Intronic
1058244342 9:102604169-102604191 CCGAGGCAGGAGAATCAGGCAGG + Intergenic
1058743271 9:107965672-107965694 CCTCGGAAGGAGTAAGGGACAGG - Intergenic
1059290778 9:113221774-113221796 CCGCGGAAGGAGAAAGAGCTCGG + Intronic
1059402982 9:114082068-114082090 TCCAGGAAGAAGGAAGGGGCCGG + Intergenic
1060016179 9:120088273-120088295 CTGAGGATGGAGAAAAGGGAAGG + Intergenic
1060369811 9:123057952-123057974 CCGAGGCAGGAGAATCAGGCAGG + Intronic
1060680064 9:125554362-125554384 CCTAGGATGGAGGAAGGGGTTGG + Intronic
1061277636 9:129578708-129578730 CCCAGGCATGAGTAAGGGGCAGG + Intergenic
1061385632 9:130287806-130287828 AAGAGGAAGGAGAGAGAGGCAGG + Intronic
1061445752 9:130636286-130636308 GCGAGGAGGGACAGAGGGGCTGG - Intronic
1061482324 9:130903249-130903271 CAGAGGCAGGAGAAATGGGATGG + Exonic
1062005735 9:134237612-134237634 CCCAGGAGGGAGAAAGGGACTGG + Intergenic
1062334944 9:136060933-136060955 CGGGGGAAGGTGAAAGGGGGAGG + Intronic
1062389026 9:136326853-136326875 CCCAGGAGGAAGGAAGGGGCAGG + Intergenic
1062490195 9:136801287-136801309 CCCAGGAAGCATAGAGGGGCAGG - Intronic
1062711554 9:137977877-137977899 CCCAGGAAGGAGTAACAGGCGGG + Intronic
1186026494 X:5319377-5319399 CCAAGCAAGGAGAATGGGGCAGG + Intergenic
1186517447 X:10176529-10176551 AACAGGAAGGAGCAAGGGGCAGG + Intronic
1186670634 X:11764237-11764259 CCGGGGAGGGTGGAAGGGGCAGG + Intronic
1187025777 X:15434074-15434096 AGGAGGAAGGAGAAAGGAGGAGG + Intronic
1187146141 X:16639035-16639057 CCGAGGATGCTGGAAGGGGCAGG + Intronic
1187377096 X:18764689-18764711 GTGAGGAAGGAGGAGGGGGCAGG + Intronic
1189298630 X:39936354-39936376 GTGAGGGAGGGGAAAGGGGCAGG + Intergenic
1189308496 X:40004914-40004936 CCCAGGAAAGAGGATGGGGCGGG + Intergenic
1189320320 X:40083568-40083590 CCGGCGAAGAAGAAAGGGGGAGG + Intronic
1190415959 X:50180741-50180763 GCGGGGAAGGAGCAGGGGGCGGG - Intergenic
1190474592 X:50814002-50814024 CCGAGGATGGAGAACCGGCCTGG - Exonic
1190607494 X:52160118-52160140 CCCAGGAAGCACAAAGGGTCAGG + Intergenic
1190915266 X:54807660-54807682 CCGAGGAAGGCGAGGGGGGGTGG + Exonic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1193058963 X:77184664-77184686 CCCAGGAAGCACAAAGGGTCAGG + Intergenic
1194663486 X:96652044-96652066 GTGAGCAAGGAAAAAGGGGCTGG - Intergenic
1196778385 X:119361492-119361514 CCGAGGCAGGAGAACCAGGCAGG - Intergenic
1196901805 X:120391001-120391023 CCCAGGAAGCACAAAGGGTCAGG - Intergenic
1198615642 X:138456042-138456064 CCCAGGAAGCAGAAGGGGTCAGG + Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200108869 X:153728921-153728943 CCGAGCCAGGAGGAGGGGGCTGG + Intronic
1201355980 Y:13097421-13097443 CAGTGGAAGGAGATAGGGGTGGG - Intergenic
1201737665 Y:17286761-17286783 GTGAGGAAGGAGAAATGGGGAGG + Intergenic