ID: 928518890

View in Genome Browser
Species Human (GRCh38)
Location 2:32068742-32068764
Sequence ACTTTAGCCGGATGTGGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48293
Summary {0: 1, 1: 5, 2: 469, 3: 8569, 4: 39249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928518886_928518890 -4 Left 928518886 2:32068723-32068745 CCTTTAAAAATGAAGTAAAACTT 0: 1
1: 2
2: 10
3: 128
4: 1093
Right 928518890 2:32068742-32068764 ACTTTAGCCGGATGTGGTGGCGG 0: 1
1: 5
2: 469
3: 8569
4: 39249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928518890 Original CRISPR ACTTTAGCCGGATGTGGTGG CGG Intronic
Too many off-targets to display for this crispr