ID: 928520876

View in Genome Browser
Species Human (GRCh38)
Location 2:32087399-32087421
Sequence GAGGTAATACATAAAAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 401}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928520876 Original CRISPR GAGGTAATACATAAAAAACA GGG (reversed) Intronic
900961704 1:5926351-5926373 ATAGTAATACATAATAAACATGG - Intronic
902223442 1:14981371-14981393 CTGTTAATACCTAAAAAACATGG - Intronic
902367267 1:15984849-15984871 GAGGGAACAAACAAAAAACAAGG - Intergenic
905426803 1:37892079-37892101 GAGGTAATAAATAATAAAGCAGG - Intronic
905598579 1:39230580-39230602 GAGGTAAAAAAAAAAAAACCTGG + Intronic
906150169 1:43583012-43583034 GAGGGAATAAAAAAAAGACAAGG - Intronic
908027478 1:59968344-59968366 GAGGCAAGACAGAAAAAGCAAGG - Intergenic
908957933 1:69658087-69658109 GATGTAATACAAAAAAACTAGGG + Intronic
909926605 1:81444819-81444841 GAGCTGATACTTAAAACACAGGG + Intronic
910130302 1:83896702-83896724 GAAGTAATACTTGATAAACAAGG + Intronic
910506726 1:87958024-87958046 GAGGTAAAAAATGGAAAACATGG + Intergenic
910661199 1:89674936-89674958 TAGGTTAAACATAAAAAACTAGG - Intronic
911261298 1:95689537-95689559 AAGGTAATAAATGAAAAAGAAGG + Intergenic
911307829 1:96252878-96252900 GAAGTATAACATAAAAAATATGG - Intergenic
911672770 1:100625850-100625872 GAGATAATGGATAAAAATCATGG + Intergenic
911982871 1:104587415-104587437 GAGGAAAAAAAAAAAAAACAGGG + Intergenic
912626145 1:111205546-111205568 GAGGGAATACACAAAGAATAGGG - Intronic
913114947 1:115688395-115688417 TAGGTGATACATAAATAACAGGG - Intronic
913222371 1:116669287-116669309 GAGGTAATAATTAACACACAAGG - Intergenic
913458716 1:119060897-119060919 GAGTTAATACATAGAATATAAGG - Intronic
914352070 1:146848862-146848884 AAAGTAATACATATAAAAGAAGG - Intergenic
915627150 1:157121696-157121718 TATGGAATAAATAAAAAACAAGG + Exonic
916399842 1:164435029-164435051 AAGGTAAAACATAAATAAAAAGG + Intergenic
916453210 1:164941370-164941392 GACATACTACATGAAAAACAAGG - Intergenic
917054537 1:170965571-170965593 GAAGTAATACATAAGAAGAAAGG - Intronic
917871361 1:179244780-179244802 GGGGTAATTTATAAACAACATGG - Intergenic
918505544 1:185249922-185249944 GAAGTAATACAAAAAGAAAAAGG - Intronic
918725568 1:187917507-187917529 GAGGCAAGTCATAAAAAGCAAGG - Intergenic
919090190 1:192969393-192969415 GAGGTTATAAAAGAAAAACAAGG - Intergenic
919518796 1:198561330-198561352 GAAGTAAGACATAAAACATAGGG + Intergenic
919582080 1:199388740-199388762 GAGAAAATAAATAAAAAAGAAGG + Intergenic
920952969 1:210590194-210590216 GTGGAACTACATAAGAAACAGGG - Intronic
924019213 1:239763237-239763259 GAGTTCATAAATGAAAAACATGG + Intronic
924217843 1:241842900-241842922 GAGGTAGCACATGCAAAACATGG + Intergenic
924618392 1:245635325-245635347 GAGGTAATAGATAATAAAAATGG - Intronic
924856153 1:247876995-247877017 GAGGTAAGAAACAAAAAATAAGG - Exonic
1063050108 10:2437725-2437747 GAGGCCATACATGAAAATCAAGG + Intergenic
1063559296 10:7111600-7111622 GAGGTAAGAGAGGAAAAACATGG + Intergenic
1064510799 10:16088850-16088872 AAGCTAATACATCAAAAACTAGG - Intergenic
1066174052 10:32885599-32885621 GAGGAATGACATAAAAAAGATGG + Intergenic
1066543277 10:36472552-36472574 GAAATAATCCATAACAAACATGG + Intergenic
1067461751 10:46463343-46463365 CAGGTATCACCTAAAAAACAAGG - Intronic
1067625443 10:47921258-47921280 CAGGTATCACCTAAAAAACAAGG + Intergenic
1068935775 10:62634100-62634122 GAGTTAACACATGAAAATCAAGG - Intronic
1068965172 10:62904665-62904687 GAGGTTGTACATATTAAACATGG + Intronic
1068972784 10:62977090-62977112 GAGTTATTACATAAGAATCATGG + Intergenic
1068987601 10:63121598-63121620 TAGGTAATTTATAAAGAACAGGG - Intergenic
1068990767 10:63148015-63148037 TAGGGAATCCATATAAAACATGG - Intronic
1069119562 10:64552039-64552061 GAGTTAAAACCTAGAAAACAAGG - Intergenic
1070188413 10:74088658-74088680 GAGGTTAAACATCATAAACAAGG + Intronic
1070660810 10:78304039-78304061 GAGAAACTACATAAAAAACCTGG + Intergenic
1071979674 10:90991138-90991160 GAGCTAAAACAAAAAAAATAAGG - Intergenic
1072601905 10:96939432-96939454 GATGTTATACCTAAAAAACTTGG - Intronic
1073742817 10:106428899-106428921 TAGTTAATAAATAAAAAATAGGG + Intergenic
1073814167 10:107187567-107187589 TGGGTAATTCATAAATAACAAGG - Intergenic
1075186280 10:120261300-120261322 GAACTAAGACATTAAAAACAAGG - Intergenic
1075422858 10:122316644-122316666 GATGTAAAAGATAAAAAAAAAGG + Intronic
1075929227 10:126280809-126280831 GAGTAAATCCATCAAAAACAAGG - Intronic
1076056689 10:127380547-127380569 GAAGAAAGACATAAAAAACACGG - Intronic
1076466897 10:130689133-130689155 TAGCTAATACACAAAAAACTGGG + Intergenic
1076548034 10:131258992-131259014 GAGAAAATAAATAAAACACATGG - Intronic
1078412886 11:11142221-11142243 GAAATAATACATACAAAACATGG + Intergenic
1079213973 11:18489439-18489461 AAGGTCATTCATAAAACACATGG + Intronic
1079914044 11:26346164-26346186 TAGCTAATACATGGAAAACATGG + Intronic
1081247829 11:40791204-40791226 GAGGTAATAAAACAAAATCATGG + Intronic
1082230251 11:49756239-49756261 GAGGTATTGAATAAAAAACAAGG - Intergenic
1083569752 11:63752669-63752691 GTGGTAAAACAGAAAAAGCAGGG + Intronic
1084482185 11:69428416-69428438 TAGGTAATACATACAAAGCTGGG - Intergenic
1085840916 11:80011084-80011106 CAGGTAATACAAAAAAAACCCGG - Intergenic
1086145518 11:83547075-83547097 GAGGTAATATTTAACAATCATGG + Intronic
1086619802 11:88872716-88872738 GAGGTATTGAATAAAAAACAAGG + Intronic
1087373123 11:97310038-97310060 GAAGTAATACATCAAATAAATGG - Intergenic
1087975469 11:104540602-104540624 GAGTAAATACATAATAATCATGG + Intergenic
1088439929 11:109858838-109858860 GAAGTAAAACAGAAAAAAAAAGG + Intergenic
1088642447 11:111886401-111886423 GAGGTAAAATATACATAACATGG + Intergenic
1089089950 11:115864110-115864132 AAAGTACTACATAAAAACCAAGG - Intergenic
1089801175 11:121029212-121029234 AAGGTAATATATAAGAAGCATGG - Intronic
1092578688 12:9816680-9816702 GAGGCAACACTTAAAAACCAGGG - Intergenic
1093533344 12:20193714-20193736 AAAATAATACATAAAAAGCATGG - Intergenic
1093762050 12:22921636-22921658 GAGGAAACAGATATAAAACATGG - Intergenic
1093958523 12:25249776-25249798 AGGGTAATACATAAGAAATAGGG + Intronic
1094114029 12:26890675-26890697 GAAGGAATACATAAAAATAAGGG + Intergenic
1095350879 12:41210755-41210777 CAGGAAATACACAAAAAATATGG - Intronic
1095406069 12:41868747-41868769 GAGTTGATACATAAGAAACGCGG + Intergenic
1095540023 12:43298845-43298867 GAGGTAAAAAAAAAAAAAGAAGG - Intergenic
1096135444 12:49196316-49196338 GATTTAATAAATTAAAAACAGGG + Intronic
1096799274 12:54098645-54098667 AAGGTAATCCATTAAAAATAAGG - Intergenic
1096943646 12:55378834-55378856 GAGGAAATAGAGAAAAAATATGG - Intergenic
1096993294 12:55822190-55822212 GAGGTAAAACAGAAGAAATAAGG + Intronic
1097317140 12:58183650-58183672 GAGAAAATACAGAAATAACAGGG - Intergenic
1097933209 12:65213923-65213945 GATGTGACACATAAAAACCAAGG - Intronic
1098408546 12:70153506-70153528 GAGGTAATTTATAAACAAAAGGG - Intergenic
1099804631 12:87502707-87502729 AATGTAATACATATACAACATGG + Intergenic
1101068933 12:101052495-101052517 GAAGTAAAAAATGAAAAACAAGG - Intronic
1101332744 12:103770082-103770104 AAAGTAATTCATAGAAAACATGG + Intergenic
1103140898 12:118547363-118547385 GAGGAAATACAAAGAAACCAGGG + Intergenic
1104555975 12:129800249-129800271 GAGGAAATGCATAGAGAACAGGG + Intronic
1104648614 12:130514687-130514709 GAGGAAAAATATAAAAAAGATGG - Intronic
1106811944 13:33367132-33367154 GAGATAATATATCAAAAACAAGG + Intergenic
1106953637 13:34911985-34912007 GAGGTGATAAAGATAAAACAAGG - Intergenic
1108263989 13:48686126-48686148 AAGATAATACTCAAAAAACATGG - Intronic
1109069003 13:57738807-57738829 GAAGTAATACATGAAAAACTTGG + Intergenic
1109292164 13:60489547-60489569 GATGAAAAAAATAAAAAACAGGG - Intronic
1110030169 13:70601204-70601226 GAGGTAAAATTTAAAAATCAAGG + Intergenic
1110127746 13:71968041-71968063 GAGGGAATAAAAAAAAAATATGG + Intergenic
1110509843 13:76336440-76336462 TAGGTAATACAGAAAAAACTAGG - Intergenic
1110722549 13:78780554-78780576 GAAGTAAAAAATAAAAAAGAAGG - Intergenic
1110964084 13:81669363-81669385 GAGGGAAGAGAAAAAAAACAAGG + Intergenic
1111191639 13:84815653-84815675 GAGGTAAAAAAAAAAAAAAAAGG - Intergenic
1111430196 13:88139201-88139223 TAGGTAAGAAATAAAAAATAAGG + Intergenic
1111476603 13:88757721-88757743 CAGGTAATAAAAAAAAAAAAAGG - Intergenic
1112526414 13:100151821-100151843 AAGGAAATACATAACAACCATGG - Intronic
1112676019 13:101703170-101703192 GAGGTAAAAAAAAAAAAATAAGG + Intronic
1112985012 13:105437917-105437939 GATGTATTACATAAAAATCATGG + Intergenic
1114845911 14:26321532-26321554 CAAGTCTTACATAAAAAACAGGG - Intergenic
1116497642 14:45582364-45582386 CAGGAAATACTTAAGAAACATGG - Intergenic
1116705904 14:48299544-48299566 TAGGTAAAACAGAAAAAAAATGG + Intergenic
1116928442 14:50666978-50667000 GAGGTAATACTTAAGTCACAAGG + Intronic
1117816753 14:59606708-59606730 GAGGAAATACAAAAATAAAAGGG - Intronic
1118858257 14:69640878-69640900 GAGGACATAGATATAAAACATGG + Intronic
1119055273 14:71413113-71413135 CATGTAATACACAAAAACCAGGG - Intronic
1119267104 14:73269291-73269313 GGGGTAAAAAAAAAAAAACATGG - Intronic
1120485334 14:85106313-85106335 GAGGTAATATATAACATGCAAGG + Intergenic
1121968198 14:98329999-98330021 CAGGTAAAAACTAAAAAACAAGG - Intergenic
1124237252 15:28001610-28001632 GAGGAAAAAAATAAAGAACAAGG + Intronic
1124593385 15:31073048-31073070 GAGATATTACACCAAAAACATGG - Intronic
1125142043 15:36419736-36419758 GAGGTAATACCAGAAAAAGAAGG + Intergenic
1126291388 15:47084263-47084285 AAGGTAATACAACAAGAACAAGG - Intergenic
1127239630 15:57098422-57098444 GAATGAATACATAAAAAAGATGG - Intronic
1127479548 15:59365933-59365955 GAGTTAAAAAATAAAAAATAAGG + Intronic
1127885493 15:63196017-63196039 GAGGGAATACATACAATCCAGGG - Intronic
1129792644 15:78351720-78351742 CAGGTAAAACAGAAAGAACAAGG + Intergenic
1130572410 15:85058859-85058881 TAGATAATACAGAAAAATCAAGG - Intronic
1131793104 15:95986339-95986361 GAGGAAATTTATAATAAACAAGG - Intergenic
1132128896 15:99255523-99255545 GAGGTAGTTCATAAAAGAAATGG + Intronic
1132345765 15:101107835-101107857 GAGGTAATTAAGATAAAACAAGG + Intergenic
1133709523 16:8387817-8387839 GATGTGATACATACACAACATGG + Intergenic
1133947780 16:10363631-10363653 GAGGAAAAAAAAAAAAAACATGG + Intronic
1134360701 16:13528586-13528608 GAGGTCATAGAAAAAAAACTGGG + Intergenic
1135885601 16:26303530-26303552 GTGGTAATAAAGAAAAAAAAAGG - Intergenic
1136054636 16:27679379-27679401 GAGGTAATTAACTAAAAACAAGG - Intronic
1137829089 16:51526703-51526725 GAGGTACTAAATAAATAACCTGG + Intergenic
1138243804 16:55451155-55451177 GATGTTATAAATAAAAAACATGG + Intronic
1139981961 16:70866670-70866692 AAAGTAATACATATAAAAGAAGG + Intronic
1140345289 16:74207377-74207399 GAGTTAATATATAAAGAACTAGG + Intergenic
1140922620 16:79552973-79552995 GAGGTAAAATTGAAAAAACATGG + Intergenic
1141165657 16:81659313-81659335 CAGATAATACAAAAATAACATGG + Intronic
1141451308 16:84105287-84105309 CAGGTACTACAGAACAAACACGG + Intronic
1142263553 16:89053463-89053485 GAGGTCATGCATAACCAACATGG - Intergenic
1142464650 17:126679-126701 GAAGTTACACATAAAAAATAGGG + Intergenic
1144380917 17:14697285-14697307 TAGGGAGTATATAAAAAACAAGG - Intergenic
1146112174 17:30099927-30099949 GAGTGAATACAGAAAAAAGAGGG - Intronic
1150985901 17:70196899-70196921 AAAGTAAGACATATAAAACAAGG - Intergenic
1151205670 17:72504760-72504782 GAGGTAACACACATAAAATAAGG + Intergenic
1152482420 17:80563581-80563603 AAGATAATAAATAAAAAATAAGG + Intronic
1152606075 17:81291055-81291077 GAGGTGACACTTAAAACACAAGG + Intronic
1153089574 18:1328888-1328910 AAGGTAATAAATAAAAAATTAGG - Intergenic
1154208440 18:12357997-12358019 GAAGTAAGACATAAAAATCAAGG + Intronic
1154225205 18:12497120-12497142 TAGGTAATAGAAAAAAACCAGGG + Intronic
1155043897 18:22087384-22087406 GAGGTAATATATAAAATTCCAGG + Intergenic
1155661315 18:28252217-28252239 GAGCTAATGCATAAAAAGTATGG - Intergenic
1155684384 18:28530733-28530755 GAGGTAATTAAGAATAAACAAGG - Intergenic
1155708678 18:28848021-28848043 GAGGAAATACAGAAAAGCCATGG + Intergenic
1156899142 18:42280340-42280362 GGGGTAATAAAAACAAAACAGGG + Intergenic
1156972385 18:43171716-43171738 GAGATAATTAATAGAAAACATGG + Intergenic
1156998151 18:43493973-43493995 GAGGTAATAAAGTTAAAACAAGG + Intergenic
1157484982 18:48080398-48080420 GAGTCAATACATGAAAAATATGG - Intronic
1158007796 18:52692884-52692906 GAGGCAAGACATAATAAGCATGG + Intronic
1158675594 18:59515064-59515086 AAAGTAATACATAAAACACAAGG + Intronic
1158779600 18:60631437-60631459 CAGGTCATGCATTAAAAACAAGG + Intergenic
1158869750 18:61674274-61674296 CAGAAAATACATAAAATACATGG + Intergenic
1159604291 18:70458879-70458901 GAAGAAAAAAATAAAAAACATGG - Intergenic
1159748333 18:72268417-72268439 GAGGGAATACAGGAAAAAAATGG - Intergenic
1163879703 19:19907452-19907474 GAAGTAATAAATAGAAAGCAAGG - Intronic
1163904523 19:20139893-20139915 GAAGTAATAAATAGAAAGCAAGG + Intergenic
1163924141 19:20322668-20322690 GAAGTAATAAATAGAAAGCAAGG - Intergenic
1163930075 19:20381105-20381127 GAAGTAATAAATAGAAAGCAAGG - Intergenic
1163933113 19:20417877-20417899 GAAGTAATAAATAGAAAGCAAGG + Intergenic
1163970011 19:20783774-20783796 GAAGTAATAAATAGAAAACAAGG - Intronic
1164284274 19:23798390-23798412 GAAGTAATAAATAGAAACCAAGG - Intronic
1164316905 19:24097896-24097918 GAAGTAATAAATAGAAACCAAGG - Intronic
1164520804 19:28977669-28977691 GAGGTAATAAAACAAAAACAGGG + Intergenic
1164896453 19:31881504-31881526 TGGGTAATACATAAAGAAAACGG + Intergenic
1165130224 19:33627411-33627433 TAGGTAATATATAAAGAAAAAGG - Intronic
1166424801 19:42668140-42668162 GAGGTAACACAGAAAATACTAGG + Intronic
1166430746 19:42724845-42724867 GAGGTAACACATAAAACACTAGG - Intronic
1166437645 19:42782416-42782438 GAGGTAACACATAAAACACCAGG + Intronic
1166451212 19:42902880-42902902 GCGGTAACACATAAAACACTAGG - Intronic
1166456588 19:42946056-42946078 GAGGTAACACATAAAACACTAGG - Intronic
1166456596 19:42946213-42946235 GAGGTAACACATAAAACACCAGG + Intronic
1166466546 19:43036925-43036947 GAGGTAACACATAAAACACTAGG - Intronic
1166466551 19:43037083-43037105 GAGGTAACACATGAAAAACCAGG + Intronic
1166469600 19:43067420-43067442 GAGGTAACACATAAAACACTAGG - Intronic
1166472689 19:43093158-43093180 GAGGTAACACATAAAACACCAGG + Intronic
1166480740 19:43170960-43170982 GAGGTAACACATAAAACACTAGG - Intronic
1166486337 19:43216342-43216364 CAGGTAACACATAAAACACTAGG - Intronic
1166486344 19:43216504-43216526 GAGGTAACACATAAAACACCAGG + Intronic
1166486368 19:43216926-43216948 GAGGTAACACATAAAACACTAGG - Intronic
1166490322 19:43254078-43254100 GAGGTAACACATAAAACACTAGG - Intronic
1166711267 19:44938963-44938985 GTGGTAAAATATAAACAACATGG + Intergenic
1166834465 19:45658758-45658780 GAGATAAGACCTAAGAAACAAGG - Intergenic
928520876 2:32087399-32087421 GAGGTAATACATAAAAAACAGGG - Intronic
928681270 2:33704945-33704967 GAGGTAGTAAATGAAAAAGATGG + Intergenic
930146826 2:48016024-48016046 GACATCATACATAAAAAGCAAGG - Intergenic
930178033 2:48320063-48320085 GAGGAAATACAGAAAAAAAGGGG + Intronic
930656806 2:54014927-54014949 GAGAAAATACACCAAAAACATGG - Intronic
931645490 2:64417995-64418017 CAGGTAATGGAGAAAAAACAAGG + Intergenic
931666322 2:64611987-64612009 AAGGTAATGAATACAAAACATGG + Intergenic
932943528 2:76198453-76198475 GAGGTAATGTAAAAGAAACAAGG - Intergenic
933191539 2:79339164-79339186 AAGTTATAACATAAAAAACATGG + Intronic
933292987 2:80458236-80458258 GAGGGACTATATAAAAAACTTGG + Intronic
934720215 2:96568993-96569015 GATATAAAACATAACAAACATGG - Intergenic
935227387 2:101064853-101064875 CATAAAATACATAAAAAACAAGG + Intronic
935425384 2:102913512-102913534 GAGCTGAAACATTAAAAACAGGG + Intergenic
938011859 2:127835199-127835221 GTTGTAAAACACAAAAAACAAGG + Intergenic
938402029 2:131001704-131001726 GAGGTTATACCCAAGAAACATGG + Intronic
938644794 2:133319458-133319480 GAGGAGATACTTAAAAAAAAAGG - Intronic
938716151 2:134023683-134023705 GAGATAATACATCTAGAACAGGG - Intergenic
939428167 2:142067979-142068001 GAGGAAAGACATGAAATACATGG + Intronic
939538138 2:143458854-143458876 GAGGTAATATATGTAAAAAATGG + Intronic
940460913 2:153961492-153961514 GAGGTAATACATAATAATAAAGG + Intronic
940506959 2:154567727-154567749 GAGGAAATTTATAAAAAACAGGG + Intergenic
940625163 2:156166337-156166359 GAGGTAATGCATTGAGAACATGG - Intergenic
940743023 2:157533822-157533844 GAGGTAGAACAAAAAAAAAATGG + Exonic
941958546 2:171229945-171229967 GAGGTAGTACCTTACAAACATGG - Intronic
943148343 2:184075427-184075449 GAAGTAAAATATAAAAAAAAGGG - Intergenic
943166999 2:184342163-184342185 TAGGTAAAACATAAAATTCATGG - Intergenic
944132437 2:196361236-196361258 AAGATACTACATAAAAACCATGG + Intronic
944357065 2:198803197-198803219 GAGATTATACATAAAAAATAAGG + Intergenic
947481936 2:230508892-230508914 GAGGTAAAAGATAAAAGAAAAGG - Intronic
1171522004 20:25783300-25783322 GTGATAATAAATAATAAACAGGG - Intronic
1171529757 20:25845248-25845270 TAGGTGATAAATAATAAACAGGG - Intronic
1171554821 20:26072583-26072605 GTGATAATAAATAATAAACAGGG + Intergenic
1171797146 20:29575696-29575718 AAGGTAATCCATTAAAAATAAGG + Intergenic
1171851102 20:30308467-30308489 AAGGTAATCCATTAAAAATAAGG - Intergenic
1173683631 20:44907234-44907256 AAGGTCATTCATAAAACACACGG - Exonic
1173769142 20:45642855-45642877 GACTGAATAGATAAAAAACAAGG - Intergenic
1174235255 20:49085003-49085025 GTGGTAATAGATATAAACCAGGG + Intronic
1175018677 20:55820666-55820688 GAGGAAAGGCATTAAAAACACGG - Intergenic
1175090394 20:56498532-56498554 GATGTCATAGATTAAAAACAAGG + Intronic
1176875354 21:14121527-14121549 GAGGTAATACAAGAAGTACAAGG + Intronic
1177224525 21:18236586-18236608 GAGGTAAAACCTAAAAGACATGG - Intronic
1178159292 21:29893243-29893265 CAGATAATAAATAAAAAACCAGG - Intronic
1178480833 21:32978223-32978245 GAGATAATTAACAAAAAACATGG + Intergenic
1178791338 21:35703028-35703050 GAGGTAATACAAGAGAAACAAGG - Intronic
1179091964 21:38274637-38274659 GAGGTAAGACAGAAAAGAAAGGG - Intronic
1179138636 21:38702502-38702524 AAAGTAATAAATTAAAAACAGGG + Intergenic
1180212078 21:46301083-46301105 GAGTTAATAAAAAAAAAAAAGGG - Intronic
1181263212 22:21613596-21613618 GCAGTAATAGATAACAAACATGG - Intronic
1182059235 22:27385260-27385282 AAGGTGATACATTAAAAAAATGG + Intergenic
1183130223 22:35827321-35827343 CAGGTAATACATAGGAAAAAAGG + Intronic
951278479 3:20718260-20718282 GAGGTAGTACCTAATAAATAAGG - Intergenic
952972957 3:38666237-38666259 GATGAAATAAATAAAAAAGATGG + Intergenic
953338804 3:42116813-42116835 GAGGAAAAAAATAAAAAAGATGG + Intronic
954753228 3:52825263-52825285 GAGGGAAGACTTCAAAAACATGG + Intronic
955150839 3:56365739-56365761 TAGGTAATACATAAATAAATAGG - Intronic
955841343 3:63116281-63116303 GAGGTAATAAATAAAAGAGCAGG + Intergenic
956751142 3:72344932-72344954 GAGGTAATACATGAGCAACCAGG - Intergenic
957012048 3:75017960-75017982 TAGGTAGTAGATAAAACACAGGG - Intergenic
957513026 3:81214539-81214561 CAGGTAATTTATAAATAACAAGG + Intergenic
959684577 3:109130489-109130511 GAGGTAATTAATTAAAAATAAGG + Intergenic
960410779 3:117321549-117321571 GAGGTAATCCAGAGAATACAAGG + Intergenic
961615693 3:128178565-128178587 GAAGTAATATATAAAACCCAAGG + Intronic
963430258 3:145192382-145192404 GAGGTAAGAGATAAAGGACAGGG - Intergenic
963574211 3:147039521-147039543 GAGGTAAGACCTAAAAAGAAGGG + Intergenic
963776623 3:149446578-149446600 TTTGTAATACATAAAACACATGG + Intergenic
964562060 3:158008760-158008782 GAGGAAATAGAAAAAAGACAAGG + Intergenic
964665133 3:159163663-159163685 GAGATAATACATGAAAAATGAGG - Intronic
965238924 3:166167526-166167548 GACATAATTCATACAAAACATGG + Intergenic
965427287 3:168542894-168542916 GAAGTACTACACTAAAAACAGGG - Intergenic
965953108 3:174334737-174334759 GAGGTAATACATGTCAAACCTGG - Intergenic
965967985 3:174519649-174519671 AGGGTAATACATGAAAAATAGGG - Intronic
966107871 3:176359455-176359477 AAGGTAATACACAGAAAACCAGG + Intergenic
966529691 3:180962054-180962076 GAGTTGATACATAAAGAGCAAGG + Intronic
966786410 3:183626843-183626865 GAATTAATAAATAAAAAGCAAGG + Intergenic
967402614 3:189080701-189080723 GACCTAAAAGATAAAAAACAAGG + Intronic
968363275 3:198164409-198164431 GAAGTTACAGATAAAAAACAGGG - Intergenic
968363286 3:198164513-198164535 GAAGTTACAGATAAAAAACAGGG - Intergenic
968363297 3:198164617-198164639 GAAGTTACAGATAAAAAACAGGG - Intergenic
968363307 3:198164721-198164743 GAAGTCACAGATAAAAAACAGGG - Intergenic
969325704 4:6442644-6442666 GAGTTAATTCATATAAAACACGG - Intronic
970396187 4:15669058-15669080 GAGGTTATATTTAAACAACATGG - Intronic
970556188 4:17235070-17235092 TAGGTAATACATAAGAAGCGGGG + Intergenic
970896527 4:21109789-21109811 GAGGAAATACACAAAGAATATGG - Intronic
971279088 4:25226504-25226526 GAGTTAATACAGACGAAACAAGG - Intronic
971291473 4:25345266-25345288 GAGGTTATACATAAACAATCAGG - Intronic
971404492 4:26309461-26309483 GAGGTATTACATAAAATAACTGG - Intronic
971767292 4:30849479-30849501 GATGTTAAATATAAAAAACATGG + Intronic
972731968 4:41803481-41803503 GAGGTAATACCTAATTAACTGGG + Intergenic
973531402 4:51840307-51840329 AATGAAATACATAAAAAAGAAGG + Intergenic
974776064 4:66483205-66483227 GAGGTGCTACATAAAGAAAAGGG + Intergenic
975914294 4:79305146-79305168 GAGGTGATTCAGAAAAGACATGG - Intronic
978037741 4:104016943-104016965 CAAGTAATACATCAAAAAGAGGG - Intergenic
978908252 4:114035395-114035417 TAGATAATATATAAAAAACAAGG + Intergenic
979526125 4:121718901-121718923 GAGGAAATATCTAAAAACCAAGG + Intergenic
979569824 4:122208196-122208218 GAGTTACTACATAAAGCACATGG - Intronic
979959719 4:127002752-127002774 GAGGGCATACATAAAAATTAGGG + Intergenic
980787747 4:137576475-137576497 GAGGAAACACAAACAAAACAAGG + Intergenic
981327558 4:143468160-143468182 GATGAAATTCATAAAAAATAGGG - Intronic
982178190 4:152726245-152726267 GAGAAAATACCTAAAACACATGG - Intronic
983811130 4:172063873-172063895 GAGGTATTACATAAAGGATAAGG - Intronic
983839826 4:172443621-172443643 CAGGTGATATATGAAAAACAAGG + Intronic
984283035 4:177695180-177695202 AAGGTAATCTTTAAAAAACATGG + Intergenic
984396660 4:179210518-179210540 GAGGAAATACATTTAAAAGAGGG - Intergenic
984406013 4:179330978-179331000 TAGGAAATACATAAATTACATGG - Intergenic
984642655 4:182185855-182185877 GCGGTTGTACATAGAAAACATGG + Intronic
986056829 5:4146180-4146202 GAGGTGACAAATAAAAGACAAGG - Intergenic
986179526 5:5380555-5380577 GATGTAATTCATGAAAAACCCGG - Intergenic
986498332 5:8370883-8370905 GCATTAATACATAAAAAAAATGG - Intergenic
987647242 5:20689785-20689807 AAAGTAATACATGAAAAAGAAGG + Intergenic
990021309 5:51130263-51130285 AATGTAATACACTAAAAACATGG - Intergenic
992304863 5:75426139-75426161 GAGGTAAAATATAAAAAAACTGG - Intronic
993200492 5:84810139-84810161 GAGGTAGAATATAATAAACAAGG - Intergenic
993563108 5:89436892-89436914 GATTAAATACATAAATAACAAGG - Intergenic
994110086 5:95992523-95992545 AAGGTCATGCATGAAAAACAAGG + Intergenic
994557458 5:101321551-101321573 GAGGTAATATAATAAGAACAAGG + Intergenic
994934662 5:106238748-106238770 GAGGTAATACATATAATACTTGG + Intergenic
995279349 5:110316062-110316084 GAGGTAAAAAAAAAAAAAAAAGG - Intronic
995313215 5:110737646-110737668 GAGGCAATTCATACAAAAAAAGG - Intronic
995488964 5:112669831-112669853 GAGGAAATACAGACAAAGCAAGG - Intergenic
995932427 5:117463843-117463865 GAAGAAATACATAAGATACAAGG - Intergenic
996179772 5:120405071-120405093 GAGGTAAAACATGATAAACTTGG - Intergenic
996201970 5:120686460-120686482 CCGGTATAACATAAAAAACAGGG + Exonic
996832829 5:127758678-127758700 TGGGTAATAGATAAAAAAAAGGG + Intergenic
997176742 5:131786379-131786401 GAAGAAATACAGGAAAAACATGG + Intronic
997600764 5:135136881-135136903 GAGGAAACACACACAAAACATGG - Intronic
998563705 5:143196486-143196508 GCAGAAATACATATAAAACAGGG - Intronic
998740660 5:145197380-145197402 TAGGTATTACTTTAAAAACATGG - Intergenic
999353597 5:150902986-150903008 TAGGTAATATGTAAAAAACCTGG - Intronic
1000549215 5:162638217-162638239 TAAATAATACATAGAAAACATGG - Intergenic
1000785022 5:165532456-165532478 GAGGTAATTAATATAAAATAAGG + Intergenic
1001041910 5:168342243-168342265 GAGGGAAAACATAAAGATCAGGG + Intronic
1003363791 6:5453659-5453681 GGTGTAAAAGATAAAAAACAGGG - Intronic
1003999445 6:11582781-11582803 GGGGTAATACACAAAAACAAAGG + Exonic
1004953498 6:20701646-20701668 GAGGTATTACGTAGAAAAAAAGG - Intronic
1005053714 6:21710097-21710119 GATGTAATACAAAAAACATATGG - Intergenic
1005372215 6:25145593-25145615 GAGGTAACCTATAAAATACATGG + Intergenic
1005513995 6:26537457-26537479 GAGGTATTTCATAAGAAACTAGG - Intergenic
1005831169 6:29672375-29672397 AAGGAAATACATAAAAGACAAGG - Exonic
1008601801 6:53103474-53103496 GAGATAATCCATATAAAAGAAGG - Intergenic
1010906524 6:81497837-81497859 GAAGTAATACACAACACACAAGG + Intronic
1012256239 6:97036258-97036280 AAAGTAATACATAAACAAAAGGG - Intronic
1012418607 6:99037029-99037051 GAGATAATACATAACACAAATGG + Intergenic
1012748108 6:103120939-103120961 GAAGTAATAAATAAGAAAAATGG - Intergenic
1013446437 6:110233267-110233289 GATGAAATACAGTAAAAACAAGG + Intronic
1013744662 6:113331507-113331529 GAGGTAAAACAAACAAACCAAGG + Intergenic
1013918549 6:115370997-115371019 GAGGAAATAAATAAAATAAATGG + Intergenic
1014134747 6:117875723-117875745 GAGTTAGTACATTAAAAACAGGG - Intergenic
1014175563 6:118327497-118327519 TAGGTACTACAGAGAAAACAGGG - Intergenic
1014414800 6:121170114-121170136 TATGTAATACATAAAATACTAGG - Intronic
1015004504 6:128262895-128262917 TAGATAATTCATAAAAAACTGGG + Intronic
1015015698 6:128410127-128410149 GAAGTAAGACATGAAAATCATGG + Intronic
1015344061 6:132134810-132134832 GAGGTAGAACATAAAAGAAAAGG + Intergenic
1016725022 6:147353997-147354019 CATGTAATACATATAAAACATGG + Intronic
1017180564 6:151547899-151547921 GAGGAAATACAGAGAACACACGG - Intronic
1022069156 7:26894028-26894050 GAGCAAAGACAGAAAAAACATGG + Intronic
1023535576 7:41205503-41205525 TAGATTATACATAAAAATCAGGG - Intergenic
1024829498 7:53432968-53432990 GAGGTAATATACAAATAGCAGGG + Intergenic
1024908795 7:54421168-54421190 CAGGAAATACGTAAAAAACAGGG - Intergenic
1025254133 7:57371867-57371889 GAGCTAATACATAAATGATAAGG - Intergenic
1025774973 7:64553197-64553219 GAAGTAATAAATAGAAACCAAGG + Intronic
1027110383 7:75433708-75433730 AAGGAATTATATAAAAAACAAGG - Intronic
1027898278 7:84074461-84074483 GGGTTAATACATTATAAACAAGG - Intronic
1027992035 7:85374900-85374922 AAGGTAAACCATAATAAACAAGG - Intergenic
1028428405 7:90717686-90717708 GAGAAACTACATTAAAAACAAGG - Intronic
1029061106 7:97798809-97798831 GTGCCAATACATAAAACACAAGG + Intergenic
1030114628 7:106053926-106053948 GAGGTAAAATAAAAAAAAGACGG - Intergenic
1030550660 7:110954963-110954985 GAGGCAATACATCAAACATAGGG - Intronic
1033277489 7:139983601-139983623 GAGAAAATATATAAAATACATGG - Intronic
1033645842 7:143303323-143303345 AAGGTAATAAATAACAAATACGG - Intronic
1033783452 7:144701104-144701126 AAGAAAATACATCAAAAACAAGG + Intronic
1033793582 7:144820891-144820913 AAGGTAATACATAGAAAACTTGG + Intronic
1034400015 7:150856164-150856186 GAGATAATACACAAAAACAAGGG + Intronic
1034605384 7:152307982-152308004 GAAGTAATTCATAAAACAGATGG + Intronic
1035532018 8:360415-360437 GAGGTAAAACAAAAAAATGAAGG - Intergenic
1035893658 8:3373269-3373291 GAGGGAAAACATCAAAAAGAGGG - Intronic
1036102016 8:5797515-5797537 GAGGAAAAACATAAAGAAAAGGG + Intergenic
1038556648 8:28524078-28524100 TAGGTAATTTATAAAAACCAGGG - Intronic
1038811778 8:30853870-30853892 TTGCAAATACATAAAAAACATGG + Intronic
1038964440 8:32555800-32555822 CAGGTAAACCATAAATAACAAGG - Intronic
1039037256 8:33373368-33373390 GTGGAAATATATTAAAAACAGGG - Intronic
1040652710 8:49466695-49466717 GATAAAATAAATAAAAAACAAGG - Intergenic
1043946126 8:86254821-86254843 TTGGTAATATATAAAAAATAAGG + Intronic
1044690570 8:94873321-94873343 GAGGTAACAGTTGAAAAACAGGG - Intronic
1045029690 8:98123305-98123327 GAAGTAATACATTTAATACAGGG - Intronic
1045187053 8:99849011-99849033 CATGTAATCCATAAAAAATATGG + Intronic
1045434119 8:102142625-102142647 GAGGTGACAAATAATAAACAAGG - Intergenic
1045744588 8:105403309-105403331 GAGGTAGTAAAGAAAAACCAGGG - Intronic
1046567185 8:115917161-115917183 GAGGTAAAATAGAAAAAAGAAGG + Intergenic
1046777760 8:118181683-118181705 GATGTAATAGAGAAAAACCAGGG - Intergenic
1046804968 8:118470291-118470313 TAGGTAATAAAAAAATAACATGG + Intronic
1047152470 8:122279696-122279718 GATGTAATACAAAAAAAATTTGG + Intergenic
1048391656 8:133972258-133972280 GAAGAAATACATTAAAAATATGG + Intergenic
1052167083 9:25344762-25344784 GTATTAATACATAAAAAATATGG + Intergenic
1052500685 9:29285661-29285683 GAAAAAATAAATAAAAAACAAGG - Intergenic
1052683595 9:31725784-31725806 GAGGAAAAACATAAAGAATAAGG - Intergenic
1054156264 9:61643019-61643041 TAGGTAATCCATTAAAAATAAGG + Intergenic
1054476038 9:65574019-65574041 AAGGTAATCCATTAAAAATAAGG + Intergenic
1054891676 9:70258741-70258763 GAGTTAAAACAAAAAAAAAAAGG + Intergenic
1055547728 9:77397767-77397789 TAGGTAATAATTAAAATACATGG - Intronic
1056078557 9:83065577-83065599 AAGGGACTACAAAAAAAACAGGG + Intergenic
1056485910 9:87058081-87058103 GAGTGAATGCAGAAAAAACAGGG + Intergenic
1056696945 9:88866381-88866403 AAGGAAATTCATAAAAAAAAGGG + Intergenic
1057984673 9:99700566-99700588 GAGATAATAGATATAAAAAATGG + Intergenic
1058799563 9:108531648-108531670 GAGGGAATAAAGAAAAAACCGGG + Intergenic
1059555988 9:115280939-115280961 GAGGTAACACATAAAACACTTGG + Intronic
1059735573 9:117096466-117096488 GATGTAATATATAAAATACCTGG + Intronic
1061732815 9:132629623-132629645 GATGTTTTACATAAAACACAGGG + Intronic
1186077306 X:5894648-5894670 GAGATAATTCATAAAACATAGGG + Intronic
1186375683 X:8996970-8996992 AAGGTAATTAATAAAAAAGAGGG + Intergenic
1186673507 X:11791798-11791820 GAGGTAATACATAAATGAATGGG + Intergenic
1188894844 X:35654322-35654344 GAGGTAATATATAAAACAGATGG - Intergenic
1189549274 X:42076450-42076472 GATGGAATACTTAAAAAAAATGG - Intergenic
1189970114 X:46409712-46409734 GAGGAAAAAAAAAAAAAACAGGG + Intergenic
1192453173 X:71255918-71255940 CAGGCAATACAGAAAAAACTAGG - Intergenic
1193151872 X:78133925-78133947 AAGGTAATAAATAGAAAACCTGG - Intronic
1194093481 X:89605309-89605331 AAGATAATACATTAAAAACATGG - Intergenic
1194114504 X:89879704-89879726 GAGGTATTACATAACAATAAAGG + Intergenic
1194627781 X:96245873-96245895 GAATTAATGCATAAAAAATAGGG - Intergenic
1194817972 X:98468461-98468483 GAGAAAACACAGAAAAAACAAGG - Intergenic
1194835942 X:98682940-98682962 GAGGCAAAACATAGAGAACATGG - Intergenic
1196224084 X:113145198-113145220 GAGGGTATACATCAAATACATGG - Intergenic
1196306289 X:114107186-114107208 GAGGGAATAAATAAAAAATCTGG + Intergenic
1196806094 X:119587617-119587639 AATGTAAAATATAAAAAACAGGG + Intergenic
1196840061 X:119851747-119851769 GAGGTAAAAAAAAAAAAAAAAGG - Exonic
1197161912 X:123333307-123333329 GAGGTAATTCATATAGAAGAAGG + Intronic
1197505499 X:127298406-127298428 GAGCTAAAACAAAAAAAAAAAGG + Intergenic
1197542848 X:127787969-127787991 GAGGTAATACATATAACACTTGG - Intergenic
1198545870 X:137692169-137692191 AAGGTAATACATCTATAACAAGG - Intergenic
1198978437 X:142364276-142364298 GAGGTAATACACAATAATCCAGG + Intergenic
1199050945 X:143236302-143236324 GAAATAATAAATAAAAAATAAGG + Intergenic
1199287780 X:146073147-146073169 GAGGTAATTAAGTAAAAACAAGG + Intergenic
1199569153 X:149250563-149250585 GAGGCAATGCATAATAATCAGGG - Intergenic
1200446110 Y:3261412-3261434 AAGATAATACATTAAAAAGATGG - Intergenic
1200467245 Y:3535070-3535092 GAGGTATTACATAACAATAAAGG + Intergenic
1200739532 Y:6838246-6838268 GAGTTAATAAATAAAAAATTTGG - Intergenic
1201507880 Y:14724591-14724613 GAGATGACACATAAAATACAGGG - Intronic
1201539552 Y:15091213-15091235 GAAGTAATACAAGAAATACAAGG - Intergenic
1201648612 Y:16262204-16262226 GAAGTAGTAAATCAAAAACAGGG - Intergenic
1201654198 Y:16323097-16323119 GAAGTAGTAAATCAAAAACAGGG + Intergenic
1201862424 Y:18613935-18613957 GAGGTAAAACTCAACAAACAGGG + Intergenic
1201863858 Y:18628700-18628722 GAGGTAAAACTCAACAAACAGGG + Intergenic
1201869464 Y:18691678-18691700 GAGGTAAAACTCAACAAACAGGG - Intergenic
1201870899 Y:18706445-18706467 GAGGTAAAACTCAACAAACAGGG - Intergenic
1202233602 Y:22682863-22682885 GAGGTAATATACATAGAACAAGG - Intergenic
1202309554 Y:23513295-23513317 GAGGTAATATACATAGAACAAGG + Intergenic
1202561247 Y:26157297-26157319 GAGGTAATATACATAGAACAAGG - Intergenic