ID: 928529852

View in Genome Browser
Species Human (GRCh38)
Location 2:32179886-32179908
Sequence AATTTACAACAGATATATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 306}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928529852 Original CRISPR AATTTACAACAGATATATAG TGG (reversed) Intronic
901159867 1:7167554-7167576 AATGCAGAACATATATATAGTGG - Intronic
904626448 1:31807677-31807699 CATTGACAACAAACATATAGTGG + Intronic
906454617 1:45983052-45983074 GATTTCCATCACATATATAGTGG + Intronic
909121560 1:71610166-71610188 ACTGTACAACATATATGTAGGGG - Intronic
909401638 1:75239169-75239191 CATTTACAACAGTTTTTTAGTGG + Intronic
910001465 1:82347350-82347372 CATTTACAACAGATCAACAGTGG + Intergenic
910048284 1:82944251-82944273 AATTTAAAATTGATATAAAGTGG - Intergenic
910462819 1:87466907-87466929 AAGTTTCAACAGATTTATGGGGG + Intergenic
912301665 1:108523386-108523408 TATATACACCAGATATATATAGG + Intergenic
912301667 1:108523414-108523436 TATATACACCAGATATATATAGG + Intergenic
912535637 1:110367699-110367721 AATTTAAAATATATATATATAGG + Intronic
912677277 1:111694989-111695011 AAGTTACTATAGATATATAAAGG + Intronic
912700215 1:111872693-111872715 AATGAACAACACATTTATAGAGG + Intronic
914976758 1:152372031-152372053 AATTTTCAACAGATGTACAAAGG + Intergenic
915010833 1:152684944-152684966 TATTTTAAACAGATATATGGAGG - Intergenic
915954233 1:160209461-160209483 AATCTAAAACAGATCTACAGAGG - Intronic
917056891 1:170992566-170992588 AGCTTAAAAGAGATATATAGTGG + Intronic
917146676 1:171899788-171899810 AATAGACAAAACATATATAGTGG + Intronic
917168588 1:172143723-172143745 AATGTAAAACAGATATTTACAGG + Intronic
917681999 1:177376750-177376772 AATGTAAAACACATATAGAGTGG + Intergenic
920026338 1:203000451-203000473 TATTTACAAAAAATATGTAGGGG + Intergenic
921554972 1:216587052-216587074 ATTTTATCACAGATATATATAGG - Intronic
923430265 1:233913143-233913165 CATTCACAACAGAAATAGAGGGG + Intronic
924518518 1:244786075-244786097 AATTTACAAAAGAAAAACAGAGG + Intergenic
1064803734 10:19107591-19107613 AATTTTCAAAATATATAGAGTGG - Intronic
1065138736 10:22699923-22699945 AATTTCTAATAGATATATAATGG + Intronic
1065143146 10:22739389-22739411 AAATTACAACGGAAATATGGAGG - Intergenic
1065184801 10:23161335-23161357 ACTTTTCAACAGCTATATTGAGG - Intergenic
1066577881 10:36846372-36846394 AATTTACAAAACATATTTAAAGG - Intergenic
1066762978 10:38774228-38774250 AATTTACTTCAGATATATAAAGG - Intergenic
1066958597 10:42198203-42198225 AATTTACTTCAGATATATAAAGG + Intergenic
1067675398 10:48370890-48370912 AATTTACAAAGAATATAAAGTGG + Intronic
1067822256 10:49540446-49540468 AAGTAAAAGCAGATATATAGTGG + Intergenic
1068215251 10:53974328-53974350 AATTTAAAACAAATCTCTAGGGG + Intronic
1068428160 10:56894704-56894726 AATTGACAACAGATATGATGAGG - Intergenic
1068481945 10:57601178-57601200 AATTTCTAACAGAAATACAGGGG + Intergenic
1068831565 10:61501677-61501699 AATTTACAACAGAACTATCCAGG + Intergenic
1070308931 10:75259108-75259130 AATTAAAAAAAGAAATATAGAGG + Intergenic
1070763406 10:79040523-79040545 AATTCACTATAGATATATATGGG - Intergenic
1071048183 10:81410224-81410246 AATTTAAAACAGAAACATAGAGG - Intergenic
1072403818 10:95131027-95131049 AATTTACAAAAGAAAGAAAGAGG - Intergenic
1072703478 10:97662239-97662261 AAATTAAAACAGATCTGTAGGGG - Intronic
1072839297 10:98753111-98753133 AATTTCCAAGAGATCTATTGTGG + Intronic
1073952042 10:108821164-108821186 AATTTACAACACATAGATTTTGG - Intergenic
1074245537 10:111687804-111687826 AATTTACAATAGAAAAATTGTGG - Intergenic
1075294352 10:121261128-121261150 AATTTACCACAATTTTATAGTGG + Intergenic
1075850566 10:125583174-125583196 AATTTACAACATATGTATCAGGG - Intronic
1077542689 11:3154797-3154819 CATTTACATTAGGTATATAGGGG - Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1080151616 11:29057920-29057942 AACTTACAAAAGAAATAGAGAGG - Intergenic
1081174075 11:39904231-39904253 AATGTAAAACAGATGGATAGTGG + Intergenic
1081249906 11:40816405-40816427 GATTCACAACAGATATCCAGAGG + Intronic
1082601657 11:55165577-55165599 AATCTGCAACAGATATCTGGGGG - Intergenic
1082851244 11:57766919-57766941 AATTTAGATCAGGCATATAGTGG + Intronic
1084587933 11:70074011-70074033 AATTTACAACTGAGATATGGTGG - Intergenic
1084629240 11:70335251-70335273 GATTTATAGCAGATATTTAGAGG - Intronic
1086720142 11:90110288-90110310 AATTTACTTCAGATATGTAACGG - Intergenic
1086848529 11:91782089-91782111 AATTTACAAGAGAGATTTAATGG + Intergenic
1086979816 11:93182545-93182567 AAATTAGAAAAGATATATAGAGG - Intronic
1087490682 11:98823191-98823213 AATTTAAAAGAAATATAGAGGGG - Intergenic
1088106882 11:106216891-106216913 AATTTACAGGATATATAGAGGGG + Intergenic
1090154085 11:124419078-124419100 AATTTACAATAAATATGTAATGG - Intergenic
1091472007 12:736882-736904 AAATTAAAAAAAATATATAGTGG + Intergenic
1093600736 12:21018760-21018782 AAAATAAAACAGATAAATAGAGG - Intronic
1093741074 12:22689841-22689863 AATTTAGTACAGATAAATATAGG - Exonic
1093823693 12:23654284-23654306 AATTTACAAGAGATAAATTATGG - Intronic
1093860810 12:24164760-24164782 AATTTAAAACAGAAAAGTAGGGG - Intergenic
1094735939 12:33233840-33233862 TATATAAAATAGATATATAGGGG - Intergenic
1095041555 12:37447663-37447685 AATTTACTGGAGACATATAGAGG + Intergenic
1095323512 12:40859148-40859170 AATTTAAAACAGATATAAAGAGG + Intronic
1098242972 12:68487310-68487332 AATTTACAACAGTAATAGAAAGG + Intergenic
1098571237 12:71989646-71989668 AATTTACAACAAAAATAAAAAGG + Intronic
1099462074 12:82934986-82935008 AATTTGAAACATATATATTGAGG - Intronic
1099716727 12:86303937-86303959 AATATGACACAGATATATAGAGG - Intronic
1100126076 12:91427354-91427376 AATATACAACAGATATAAAAGGG + Intergenic
1100251563 12:92830140-92830162 AATTTAAAAAATATATTTAGGGG - Intronic
1100845946 12:98657907-98657929 TATTTACATCAGATATTTATTGG - Intronic
1103135500 12:118503467-118503489 TATTCACAACAGATAAAAAGTGG - Intergenic
1104162893 12:126197744-126197766 AATTTTCAACAGATTTACTGGGG - Intergenic
1105384166 13:19914727-19914749 AATTTACAGCAGATGAAGAGTGG + Intergenic
1105527709 13:21191484-21191506 AATTTTCAACAGAGATACACAGG + Intergenic
1105581583 13:21702170-21702192 AATTTACCACAGGTTCATAGCGG - Exonic
1105973157 13:25449712-25449734 ATTTAATAACAGATATATAATGG - Intronic
1108058215 13:46506167-46506189 AATTTCCAACAGTGATAGAGTGG - Intergenic
1108289312 13:48942461-48942483 AATATAAAACAAATATATATTGG - Intergenic
1108794156 13:54010849-54010871 AATTTACATCAAATAAATGGAGG + Intergenic
1110635500 13:77762893-77762915 AATTTGCAACATAAATAAAGGGG - Intronic
1111120641 13:83844409-83844431 AATATATAAGAGATATATGGTGG - Intergenic
1115310165 14:31971406-31971428 AATATGCAACAAAAATATAGAGG - Intergenic
1115615115 14:35087184-35087206 AGTGTACAACAGATATTTACAGG + Intronic
1115867382 14:37762027-37762049 AATCTAAAACAAATATATAGAGG - Intronic
1116381646 14:44276529-44276551 AATTTAATACAGATATCTAAAGG - Intergenic
1117695726 14:58360415-58360437 ATTTTAAAACACATATATACTGG + Intronic
1118156223 14:63244817-63244839 AATTTTCAACAAATAAATAAAGG + Intronic
1119454509 14:74743219-74743241 AATTTACACAAGATTTATTGGGG + Intergenic
1119501853 14:75135477-75135499 AATTTTCAACATTTATATATAGG - Intronic
1120592117 14:86388846-86388868 AATTCCTAACAGATATATATTGG + Intergenic
1202934302 14_KI270725v1_random:70479-70501 AATTTACTTCAGATATATAAAGG - Intergenic
1124128309 15:26960214-26960236 AATTTAGAACATATACATATTGG + Intergenic
1126126726 15:45300729-45300751 AATTTCCAAAAAATATAAAGAGG - Intergenic
1126745863 15:51825984-51826006 AATCTACCACAGGTATTTAGTGG + Intergenic
1127415507 15:58753122-58753144 ATTTTACAAAAGAAATATTGAGG - Intergenic
1129093810 15:73181971-73181993 AATTTACAAAAGAGATTTAATGG + Intronic
1130974099 15:88759742-88759764 AATATATCACAGATATAAAGTGG + Intergenic
1131758152 15:95588709-95588731 AATTTAAATGAGATAGATAGGGG + Intergenic
1133966169 16:10533382-10533404 AAATTACAACTGATATTTTGTGG + Intronic
1136011421 16:27365872-27365894 AGTTAGCAACAGATCTATAGTGG + Intergenic
1136481542 16:30545160-30545182 AATTTAAAAAATATATATACTGG + Intronic
1138829933 16:60362801-60362823 AATTGACAATATACATATAGTGG + Intergenic
1138898708 16:61242408-61242430 ACTTTACAGCAAATTTATAGTGG + Intergenic
1139813840 16:69649626-69649648 AATTTATAACAACTATATTGAGG + Intronic
1141536675 16:84686186-84686208 AATTTACGATAGATTTATTGGGG + Intergenic
1146608178 17:34280585-34280607 AATCTACCAGAGATATAAAGAGG + Intergenic
1146818643 17:35965992-35966014 GATTTTCAACTGATATATACGGG - Intergenic
1149039481 17:52170962-52170984 AATTTACAAATGAGGTATAGGGG + Intergenic
1149139766 17:53417827-53417849 AATTTACAACAGCAATAAACAGG + Intergenic
1150511746 17:65759863-65759885 TACTTACAACAGATTTATCGGGG - Intronic
1151098768 17:71531551-71531573 AATTTAAAACAGATGTACAATGG - Intergenic
1151280540 17:73070886-73070908 AATTTACAAAAGAGATGTAATGG - Intronic
1154399048 18:14017725-14017747 AACTTACAAAAAATATATAAAGG + Intergenic
1155632889 18:27915437-27915459 TATTTGCAACATATATACAGAGG + Intergenic
1159506171 18:69339551-69339573 ACTTTACATCAGATGTAAAGCGG + Intergenic
1159524022 18:69564744-69564766 CATTTACAACAGATAATTAAAGG - Intronic
1159765553 18:72484089-72484111 AATTTTCCACAGCTATTTAGTGG - Intergenic
1164174598 19:22759850-22759872 AATTTTCAACAAATATATTTTGG - Intronic
1164655685 19:29919753-29919775 ACTTTACCTCAAATATATAGTGG + Intergenic
1167111201 19:47462562-47462584 AATTTAAAAAAGATATACATAGG - Intronic
925721427 2:6831832-6831854 AAATTAAAAAAGAAATATAGAGG + Intergenic
926817451 2:16814073-16814095 AATTTACAAAAGATGTTTAGTGG + Intergenic
927828977 2:26331779-26331801 TATTTATAACAGATATCTAAAGG - Intronic
928529852 2:32179886-32179908 AATTTACAACAGATATATAGTGG - Intronic
931642139 2:64391323-64391345 ATTTGAAAACAGATATTTAGAGG - Intergenic
931932657 2:67157978-67158000 ATATTAAAACAAATATATAGTGG + Intergenic
932205617 2:69878951-69878973 AAGTTACAGCAGATATATAAAGG - Exonic
933697367 2:85229694-85229716 ATTTTAAAACTGATATATATTGG - Intronic
934306954 2:91833850-91833872 AATCTACTTCAGATATATAAAGG + Intergenic
934326302 2:92018892-92018914 AATCTACTTCAGATATATAAAGG - Intergenic
934464657 2:94249507-94249529 AATTTACTTCAGATATATAAAGG - Intergenic
935042331 2:99444697-99444719 AGTATACAACTGATAGATAGTGG - Intronic
935613653 2:105053545-105053567 TATTTACAACAGATACAAACTGG + Intronic
938324078 2:130385920-130385942 AATTGAAAACAGAGAAATAGTGG - Intergenic
939068614 2:137514048-137514070 AATTTTCAATTGATATCTAGTGG - Intronic
940108953 2:150129275-150129297 AATTTGCATCAGGTGTATAGTGG + Intergenic
942602007 2:177651234-177651256 AATTTACAGCAGAGATACTGAGG + Intronic
942983012 2:182105269-182105291 AATTTAAGACAGATTTAAAGAGG + Intronic
943826848 2:192405569-192405591 AATTTCCAAAAGAAATATAAAGG + Intergenic
944050031 2:195457486-195457508 AGTTTGCACCATATATATAGTGG - Intergenic
944372040 2:198995866-198995888 AAATTACAATGGAGATATAGTGG + Intergenic
944380175 2:199099983-199100005 ATTTTAAAATATATATATAGTGG + Intergenic
944431230 2:199635775-199635797 AATATACAACAGATATGGAGGGG - Intergenic
944902282 2:204227815-204227837 AATTTAAAAAATATATATCGGGG + Intergenic
945776066 2:214107693-214107715 AATTTATAAAATATATACAGTGG - Intronic
1169248031 20:4039081-4039103 CATTCAAAACAGATAAATAGAGG + Intergenic
1169649162 20:7847665-7847687 AATTTAAAACAGAAATACCGAGG + Intergenic
1170044149 20:12067399-12067421 AATTTAAACAATATATATAGAGG + Intergenic
1170522535 20:17202298-17202320 AATTTACATCAGAAACAGAGAGG + Intergenic
1174758191 20:53180749-53180771 AATTTAAAAAATATATTTAGGGG - Intronic
1174956577 20:55104827-55104849 AGTTTACCACAAGTATATAGGGG + Intergenic
1176595703 21:8692681-8692703 AATTTACTTCAGATATATAAAGG - Intergenic
1177264120 21:18762275-18762297 AATTTATAACAGAAATGTATTGG + Intergenic
1177926145 21:27217945-27217967 AATTGAAAACAGAGAGATAGAGG - Intergenic
1178158702 21:29885824-29885846 AATTTATAACTGATATAAACAGG + Intronic
1178810249 21:35875146-35875168 TATTTTCAACAGATATTTATAGG - Intronic
1180278563 22:10669794-10669816 AATTTACTTCAGATATATAAAGG - Intergenic
1180585815 22:16888658-16888680 AATTTACTTCAGATATATAAAGG - Intergenic
1180689707 22:17702849-17702871 AATTTAAAAAATATATATATAGG + Intronic
1181432553 22:22891071-22891093 AATTTACCACAGTTTTATGGTGG - Intronic
1182124674 22:27807779-27807801 AATTTATATAAGTTATATAGTGG - Intergenic
949309367 3:2679002-2679024 AATTCAAAACAGATATATAGGGG - Intronic
950705758 3:14779966-14779988 AATTTAAACCAAAAATATAGAGG + Intergenic
951056092 3:18148041-18148063 AATTAACAATTGAAATATAGAGG + Intronic
951247888 3:20362187-20362209 ATTTTACAAAAGAAAAATAGAGG + Intergenic
951946621 3:28144347-28144369 ATTTTACAACTCTTATATAGAGG + Intergenic
952120893 3:30243215-30243237 AATTTACAAGAGATCTAATGTGG - Intergenic
952359549 3:32615930-32615952 AATTTAATACAGTTATAAAGGGG - Intergenic
953328368 3:42031678-42031700 ATTTTACAACACATATACTGAGG - Intronic
955484392 3:59420952-59420974 AATTTACAACATAGAAAGAGAGG - Intergenic
955729386 3:61968532-61968554 AATTTACCACAAATATTTTGGGG - Intronic
955831800 3:63012647-63012669 AATTTACTACAGTTACAAAGAGG - Intergenic
957250210 3:77762847-77762869 AATATAAAACTGATATATTGGGG - Intergenic
958687124 3:97413064-97413086 AAACTACAACAGAAATTTAGAGG - Intronic
958695971 3:97527476-97527498 CAATTAAAACAGATATCTAGGGG - Intronic
959260579 3:104074610-104074632 AATTTTCCACAGATGTAGAGAGG + Intergenic
959746998 3:109787230-109787252 AATTTAAAATAAATAAATAGAGG + Intergenic
962062315 3:131943068-131943090 AATTTACAAAAGTAATAAAGTGG + Intronic
964378326 3:156071449-156071471 AATTTACAAAGGATATATGGAGG - Intronic
965050262 3:163637790-163637812 AATATAGAAAAGATTTATAGAGG + Intergenic
965927453 3:173999451-173999473 TTTTTACAACATATATTTAGAGG - Intronic
966461167 3:180178365-180178387 AAATTACAACATATTTATATTGG - Intergenic
969946620 4:10790062-10790084 AATTGACAATGGATATATATGGG - Intergenic
971633507 4:29026954-29026976 AATTTAAAACAGAAATGTACAGG + Intergenic
971860762 4:32102362-32102384 AACTTACTACAAAAATATAGGGG + Intergenic
972111659 4:35568856-35568878 AATTAAATACAAATATATAGTGG - Intergenic
972471344 4:39407663-39407685 AATTCACAACCCATATCTAGTGG + Exonic
972836883 4:42881984-42882006 AAATTCCAAAAGCTATATAGAGG - Intergenic
973060723 4:45720118-45720140 AATTGAAAATAGATATATTGAGG + Intergenic
973594208 4:52469187-52469209 AATTTAAAACAGAAAAATAATGG - Intergenic
974304852 4:60121850-60121872 AATATACATTAGATATATACCGG + Intergenic
974678660 4:65132311-65132333 AATTTAATACAAACATATAGGGG + Intergenic
975211065 4:71700671-71700693 AATTTAGAACAGATCCATAATGG - Intergenic
975304169 4:72829336-72829358 ACTTTACAATAGACTTATAGCGG + Intergenic
975945398 4:79699553-79699575 AATTAATATCAGAAATATAGGGG - Intergenic
977065540 4:92309088-92309110 AATTTATAACAGATATTTAGTGG - Intronic
978145607 4:105367538-105367560 AATTATCAAGAGATAGATAGTGG - Intergenic
979560450 4:122096043-122096065 AAGTTACAAGAGATTTATCGTGG + Intergenic
980258663 4:130418219-130418241 AATTTATAGATGATATATAGAGG - Intergenic
980646346 4:135646703-135646725 AATTTTCAACAGAATTCTAGAGG - Intergenic
980767818 4:137331128-137331150 AATTAACAACAGACCTAGAGGGG - Intergenic
980819863 4:138000099-138000121 AATTGATAACAAATATATATTGG + Intergenic
981178131 4:141706384-141706406 AAATTACAACAGCTACATAATGG - Intronic
982142411 4:152338987-152339009 AATTGACAACAGATATATTAAGG + Intronic
982574640 4:157094300-157094322 CAGTTACAAAAGATATATACTGG - Intronic
983110222 4:163740838-163740860 AGTTCACAAAAGATACATAGTGG + Intronic
983530864 4:168808625-168808647 AATTTACAAAAGAGATTTATTGG + Intronic
984252856 4:177355198-177355220 AATTTATAACATATAAATGGAGG + Intronic
984477346 4:180253486-180253508 ATTTTACAGCAGATATACATTGG - Intergenic
985417951 4:189755784-189755806 AAATTACAATAGTTATGTAGTGG - Intergenic
986799910 5:11248082-11248104 ATTTTAAAATAGATACATAGTGG - Intronic
987199826 5:15565510-15565532 AATTAAGAATAAATATATAGAGG - Intronic
988104635 5:26728796-26728818 AATTTACAAGAGATAGCTAAAGG - Intergenic
988116346 5:26897227-26897249 ATTTTACCAGAGATACATAGAGG + Intronic
988273694 5:29052857-29052879 AATTAACAACAGAAACATACAGG + Intergenic
988471775 5:31546568-31546590 AATTTACAAAAGAGATTTAATGG + Intronic
991997544 5:72402919-72402941 AATTAACAAAAAATATTTAGTGG - Intergenic
992021178 5:72625725-72625747 TATTTACTACAGATATCTACAGG + Intergenic
992631019 5:78680611-78680633 AATTTACCACAGTAATTTAGTGG - Intronic
992697790 5:79307707-79307729 ACCTTACTAGAGATATATAGAGG - Intronic
993245065 5:85440404-85440426 CATTTTCTACAGATATATAATGG - Intergenic
993491847 5:88561358-88561380 AATATCCAACAGATACATAATGG + Intergenic
994384643 5:99116024-99116046 AATTTAAAACAAATATAGAGTGG - Intergenic
995005394 5:107187388-107187410 AATCAACAAATGATATATAGAGG + Intergenic
995661352 5:114486813-114486835 AATTTACCACAGAAAGAAAGTGG + Intronic
996406252 5:123107302-123107324 ATTATCCAACAGATATATTGTGG + Intronic
996550005 5:124720728-124720750 AAATTTCAACAGAGATAAAGGGG + Intronic
996562071 5:124841897-124841919 AATATACATCAGATAGATGGGGG + Intergenic
997244903 5:132339214-132339236 TATTTACAACATATATACAAGGG - Intronic
997551263 5:134755271-134755293 AATTTACTATAAATATATTGTGG + Intergenic
998859184 5:146426260-146426282 AGGTCACAACAGATAAATAGTGG + Intergenic
998953905 5:147418686-147418708 AATTTCCAAGACAAATATAGTGG + Intronic
999139909 5:149353234-149353256 AATTTACAATATATACTTAGTGG - Exonic
999628233 5:153542617-153542639 GGTTTACAGCAGATATACAGTGG + Intronic
1000629163 5:163572308-163572330 CTTTTTGAACAGATATATAGAGG + Intergenic
1001369914 5:171188737-171188759 AACCTACCACAGATACATAGTGG - Intronic
1002288883 5:178185783-178185805 AAGTTACAGCAGATATATAAAGG + Intergenic
1003801620 6:9676142-9676164 AAATTTCCACAGATATATAAAGG - Intronic
1007297175 6:40833467-40833489 AATTTCTTACAGATATAGAGAGG - Intergenic
1008798651 6:55339431-55339453 AATCTAAAACAGAGATATAGAGG + Intronic
1008969437 6:57349436-57349458 AATTTAAAACAAAAAAATAGTGG - Intronic
1009158409 6:60251267-60251289 AATTTAAAACAAAAAAATAGTGG - Intergenic
1010048946 6:71481036-71481058 AATTTAAAAGAGATCTATAGTGG + Intergenic
1010076803 6:71808283-71808305 AATTTACAAAAGAAAGAGAGAGG + Intergenic
1010116723 6:72321217-72321239 AAACTACAACAGATATATCAAGG + Intronic
1010454688 6:76041314-76041336 AATTTACAACACAATTACAGTGG - Intronic
1010602642 6:77849706-77849728 AAAGTAGAACAGATATTTAGCGG + Intronic
1011161953 6:84401233-84401255 GATTTACAAAAGATATAAAATGG + Intergenic
1011269537 6:85563327-85563349 AATATACTACAAATATATATAGG + Intronic
1012217714 6:96608321-96608343 AATTTACAAAATATTTATATTGG + Intronic
1012269261 6:97188396-97188418 AATTTCTAGCACATATATAGAGG - Intronic
1013966005 6:115956212-115956234 TATTCACAACAGATATATTAGGG - Intronic
1014199746 6:118595327-118595349 AAATTACAACAGCTAAAAAGTGG + Intronic
1015723276 6:136269053-136269075 AATTTTAAACTGATATCTAGTGG - Intronic
1016586145 6:145688754-145688776 AACTTACAAAAGATGAATAGAGG + Intronic
1016624318 6:146147763-146147785 AATTTACAACAAACAGAGAGGGG + Intronic
1016948766 6:149560263-149560285 TATTCACAATAGAAATATAGAGG + Intergenic
1020628119 7:10607984-10608006 AATTTACAACAAATACATAGTGG - Intergenic
1022711050 7:32850652-32850674 AATTTACAAAAGAGGTATAATGG + Intergenic
1022871559 7:34485539-34485561 ATGTTACAACAGATATATGATGG - Intergenic
1023292167 7:38679877-38679899 ACTTTAAAACAGATATATTTAGG + Intergenic
1023461569 7:40403560-40403582 AAGTTACAACAGACATAAAATGG + Intronic
1023665050 7:42514240-42514262 AATTAACAACAGCCATTTAGCGG + Intergenic
1028254612 7:88578495-88578517 AATTTTTAACAGATTTATTGAGG + Intergenic
1030609282 7:111671118-111671140 TATTGAAAACAAATATATAGAGG - Intergenic
1030794527 7:113770866-113770888 AAATTACTACAGATATTTATGGG - Intergenic
1031196616 7:118623094-118623116 AATTAATAACAGATTTTTAGAGG + Intergenic
1031460434 7:122042348-122042370 AATCTCCAACAGATATAGTGAGG + Intronic
1031981913 7:128133330-128133352 AACCTACAACAGGTATATGGGGG + Intergenic
1032449043 7:132011840-132011862 ATTTCACAACTGATATAAAGTGG - Intergenic
1032848707 7:135773941-135773963 AATTTAAAAAAGATTTATACAGG + Intergenic
1033763918 7:144466340-144466362 TATTTACAACACAGAAATAGGGG + Intronic
1033771759 7:144560189-144560211 AATTAACAACTGATATTAAGCGG + Intronic
1033883787 7:145919516-145919538 ATTTTACAACAGATATATGCAGG - Intergenic
1034719524 7:153277440-153277462 AATTTATATTAGATATATTGGGG - Intergenic
1035130516 7:156648510-156648532 AATTTAAATTAGATATAAAGAGG + Intronic
1036583044 8:10094944-10094966 ATTTTACTACAGATGTACAGGGG - Intronic
1036994459 8:13639382-13639404 CATTTACAATAGAAAGATAGTGG - Intergenic
1038839258 8:31164941-31164963 AATTTACCATAGAAATATAAAGG + Intronic
1041318178 8:56585439-56585461 TATTTACACCAGATTTCTAGGGG + Intergenic
1041426458 8:57726239-57726261 AACTTACAACAGATGAAAAGAGG - Intergenic
1043240738 8:77931764-77931786 AATATACAGGAGATACATAGGGG + Intergenic
1043394175 8:79820693-79820715 AATTTACAACCGATGGATTGTGG - Intergenic
1043918027 8:85946858-85946880 AATTTTTAACAGATAGATACAGG + Intergenic
1044680383 8:94771869-94771891 CATTTACAAAATATATATATAGG + Intronic
1045798283 8:106071675-106071697 CATTTATTATAGATATATAGAGG - Intergenic
1046171787 8:110517770-110517792 AATAGACAATAGATATAAAGTGG - Intergenic
1047268790 8:123334678-123334700 ATTTTGCAAGAGATTTATAGAGG + Intronic
1047688093 8:127321730-127321752 CATTTCCAAAAGATATTTAGAGG - Intergenic
1048485364 8:134842994-134843016 AATTTTCAAAACATATATAAAGG - Intergenic
1049829064 8:144688072-144688094 AATATACAAAATATTTATAGAGG + Intergenic
1050170974 9:2816254-2816276 AATGGATAACAGAAATATAGAGG + Intronic
1051093902 9:13442961-13442983 CATTTACAACACATATTAAGTGG + Intergenic
1051172667 9:14334589-14334611 AATCTGCAACAGATATAAACTGG - Intronic
1051377098 9:16413221-16413243 AATTTACAACAGCACTTTAGAGG + Exonic
1052402105 9:28013248-28013270 AATTTAAAATACATATATAAAGG - Intronic
1052618372 9:30872747-30872769 AACTTACAACAGTTATTTAATGG - Intergenic
1053165017 9:35838207-35838229 AAGGTACAAAAGATATACAGTGG + Intronic
1053555575 9:39133529-39133551 AATTTATAAAAGATACATATTGG + Intronic
1053694746 9:40626271-40626293 AATTTACTTCAGATATATAAAGG - Intergenic
1053819691 9:41953776-41953798 AATTTATAAAAGATACATATTGG + Intronic
1053941731 9:43256647-43256669 AATTTACTTCAGATATATAAAGG - Intergenic
1054109959 9:61097433-61097455 AATTTATAAAAGATACATATTGG + Intergenic
1054270094 9:63013845-63013867 AATTTACTTCAGATATATAAAGG + Intergenic
1054305990 9:63425495-63425517 AATTTACTTCAGATATATAAAGG - Intergenic
1054404733 9:64749477-64749499 AATTTACTTCAGATATATAAAGG - Intergenic
1054438357 9:65234969-65234991 AATTTACTTCAGATATATAAAGG - Intergenic
1054492047 9:65786979-65787001 AATTTACTTCAGATATATAAAGG + Intergenic
1054610898 9:67233692-67233714 AATTTATAAAAGATACATATTGG - Intergenic
1054887953 9:70219554-70219576 AATTTTCTACAGATATAAATGGG + Intronic
1055783538 9:79846067-79846089 AATTTCCCACAAATATAGAGTGG + Intergenic
1055830174 9:80368938-80368960 AATTTCCCACAGATATAGAAAGG + Intergenic
1056811361 9:89766720-89766742 AATTTTTAACAGCTATATTGAGG + Intergenic
1058315716 9:103562998-103563020 ATTATACAACAGATAGATATGGG + Intergenic
1061692230 9:132342546-132342568 AATTTACTACAGTTAAGTAGAGG - Intronic
1187785549 X:22881446-22881468 GATTTACAACAGGTATAAACAGG - Intergenic
1188137763 X:26510731-26510753 AAATTACCATACATATATAGTGG - Intergenic
1190954875 X:55183053-55183075 AATTTTCTACACACATATAGAGG - Intronic
1192488446 X:71551785-71551807 AATTTACAGGAGATATACACGGG + Intronic
1192564105 X:72148606-72148628 ACTTTGAAACAGATTTATAGAGG + Intergenic
1193730349 X:85095483-85095505 AATTAAAAACATATATACAGGGG + Intronic
1194277631 X:91906173-91906195 AACTTACTACAGATATGTAGAGG + Intronic
1194586235 X:95737292-95737314 AATTTAAAACAGATGTTTTGAGG + Intergenic
1194771087 X:97906370-97906392 AATTTAAAACATATAAAAAGTGG + Intergenic
1196317741 X:114248843-114248865 AATTAAAAAAATATATATAGAGG + Intergenic
1197829686 X:130628129-130628151 TATGTACAACAGAAATATACTGG + Intronic
1198063349 X:133070165-133070187 AATTTAAAACAAATATGAAGAGG + Intronic
1198923659 X:141761957-141761979 AATTGACCACAGACATATATTGG + Intergenic
1200594971 Y:5128248-5128270 AACTTACTAAAGATATGTAGAGG + Intronic
1200888932 Y:8301250-8301272 AATTTAAAAAAGAAATAAAGAGG - Intergenic
1200947455 Y:8859957-8859979 AATTGACCACAGACATATATTGG + Intergenic
1201192552 Y:11458219-11458241 AATTTACTTCAGATATATAAAGG - Intergenic
1201232986 Y:11883375-11883397 AATTTAGAATACATATATAGAGG - Intergenic
1201456990 Y:14178871-14178893 GATTTACTATATATATATAGTGG + Intergenic
1202428032 Y:24742673-24742695 AATCTACAACAGACACCTAGGGG - Intergenic
1202442759 Y:24927418-24927440 AATCTACAACAGACACCTAGGGG + Intergenic