ID: 928536787

View in Genome Browser
Species Human (GRCh38)
Location 2:32248924-32248946
Sequence TAGTTATGGCAGATGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 1, 2: 15, 3: 59, 4: 293}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928536787_928536792 29 Left 928536787 2:32248924-32248946 CCCTGTTCCATCTGCCATAACTA 0: 1
1: 1
2: 15
3: 59
4: 293
Right 928536792 2:32248976-32248998 AGTAACTTTCTCCTGATCAGAGG 0: 1
1: 2
2: 7
3: 21
4: 148
928536787_928536790 -10 Left 928536787 2:32248924-32248946 CCCTGTTCCATCTGCCATAACTA 0: 1
1: 1
2: 15
3: 59
4: 293
Right 928536790 2:32248937-32248959 GCCATAACTACAGCTTTGATTGG 0: 28
1: 62
2: 80
3: 55
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928536787 Original CRISPR TAGTTATGGCAGATGGAACA GGG (reversed) Intronic
900481463 1:2901536-2901558 TAGTTGTGGCTGATTGATCAGGG - Intergenic
904276225 1:29386204-29386226 TAGTTATGGCTTGTGGAACTGGG - Intergenic
904634117 1:31866520-31866542 TAGTTATGGCTTGTGGAGCAGGG - Intergenic
904951633 1:34245847-34245869 TAGTCGTGGCTCATGGAACAGGG - Intergenic
905968036 1:42115944-42115966 TAGTCAGAGCAGAGGGAACAAGG + Intergenic
906206445 1:43989772-43989794 TAATTATGGCTTGTGGAACAGGG + Intronic
906918277 1:50035380-50035402 TAGCTATGGAAGATGTATCAGGG - Intergenic
907063437 1:51454805-51454827 TAGTTTTGACAGATGTACCATGG + Intronic
908897387 1:68915600-68915622 TAGTTAGGGCTGGTGGGACAGGG - Intergenic
911152906 1:94612139-94612161 TAGTGATGGCTTGTGGAACAGGG + Intergenic
913246008 1:116870617-116870639 TAGATAGGGCAGAATGAACAAGG - Intergenic
913283443 1:117207301-117207323 TAGTGATTTCAGATGAAACAGGG + Intronic
913676328 1:121144331-121144353 TTGTAATGGGAGATGAAACATGG + Intergenic
914028223 1:143932281-143932303 TTGTAATGGGAGATGAAACATGG + Intergenic
916148538 1:161763304-161763326 TAGCTATGGCTGGTGGAACGGGG + Intergenic
917687502 1:177432220-177432242 GACTTATAGCAGGTGGAACATGG - Intergenic
919078229 1:192837936-192837958 TAGTTAAGGAAGATGGGAAAGGG - Intergenic
920187486 1:204169711-204169733 TAGTTATGGCTGGTGGAACTGGG - Intergenic
920463694 1:206163172-206163194 TTGTAATGGGAGATGAAACATGG + Intergenic
920811344 1:209288716-209288738 TAGTGATGGCAGCTGGACCCAGG + Intergenic
921812881 1:219534553-219534575 TAGTGATGGCAGTTGTAGCATGG - Intergenic
923130883 1:231073740-231073762 TAGTTATGGCTGGTGGAACAGGG - Intergenic
1063988745 10:11536738-11536760 TAGTTATGGGAGATGCAAGTGGG - Intronic
1065078604 10:22105394-22105416 TACTCATGGCAGAAGGCACAGGG - Intergenic
1066695514 10:38073896-38073918 CAGTTATGGCTTGTGGAACAGGG - Intergenic
1067050595 10:43016321-43016343 TAGTCATGGCAGAGGGCAAAAGG - Intergenic
1067244016 10:44521150-44521172 TAGTTTTGACAAATGGACCATGG - Intergenic
1069576178 10:69530222-69530244 GAGTTCTGGCTAATGGAACAGGG - Intergenic
1071173848 10:82900048-82900070 TAATTATGGCAGAAGGCAAAGGG + Intronic
1071493101 10:86149895-86149917 TATTTATTGCAGTGGGAACAAGG - Intronic
1072492802 10:95924112-95924134 TATTTATTCCAGATGGAAAAGGG + Intronic
1073001012 10:100286322-100286344 AAATTATGGCAGATGGAGAATGG - Intronic
1073499581 10:103923753-103923775 AGGTTATGGCAGTGGGAACAGGG - Intergenic
1073886603 10:108046989-108047011 TAATCATGGCAGAAGGAAAAGGG + Intergenic
1074260175 10:111845754-111845776 TAGTCATGGCAGAAGGTAAAGGG + Intergenic
1074632046 10:115269186-115269208 TATTTATGGCAGATGAAAATGGG + Intronic
1076638306 10:131897720-131897742 TAGTTACGGCTGCTGGAGCAGGG - Intergenic
1078853859 11:15190455-15190477 TAGTTATGGCCTATGTATCAAGG + Intronic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079867495 11:25755356-25755378 TAATTATGACAGATTGAAGATGG - Intergenic
1080034277 11:27696056-27696078 TATTGATGGCAGATGCAAAATGG - Intronic
1080079421 11:28197886-28197908 TAGTGATGGCAGTTTCAACATGG - Intronic
1080182424 11:29441476-29441498 CAGTTATGGCAGAAGGCAAAGGG + Intergenic
1080426609 11:32160513-32160535 TAGTTCTGGCTGGTGGAACAGGG + Intergenic
1081501106 11:43667493-43667515 TTATTATGGCAGAAGGAAAAGGG - Intronic
1081696020 11:45109622-45109644 GAGGTGTGGGAGATGGAACAGGG + Intronic
1083554830 11:63617835-63617857 CAGTCATGGCAGAAGGAAAAAGG - Intergenic
1085251400 11:75146322-75146344 TAGTTATGGCTGGTGGAACGGGG - Intronic
1086314357 11:85574737-85574759 TAGTCATGGCAGAGGGAAAGAGG - Intronic
1088939037 11:114435245-114435267 CAGTTATGGCAGAAGGCAAAGGG + Intronic
1089543313 11:119204249-119204271 TACTTCAGGCAGATGGAATAAGG + Intergenic
1091861558 12:3789895-3789917 TAGTCATGGCAGAAGGCAAAGGG + Intergenic
1091983173 12:4883065-4883087 TAGTTATTGCAGATGAAACGTGG - Intergenic
1092865548 12:12757625-12757647 TACTTTTGGGAGATGGAAGAGGG - Intronic
1093356852 12:18177043-18177065 TAGTTTTGGGAGATGGAAGCTGG - Intronic
1093685373 12:22048015-22048037 TTGTTATGCCAGTTTGAACAGGG - Intronic
1093896007 12:24574961-24574983 TAATCATGGCAGAAGGAAAAAGG + Intergenic
1094276803 12:28686240-28686262 TAATTATGGCAGAAGGAGAATGG + Intergenic
1094440678 12:30472480-30472502 TAGTCATGGCTCATGGAACAGGG - Intergenic
1094446250 12:30533756-30533778 TACTTTTGGCTAATGGAACAGGG - Intergenic
1095226583 12:39685349-39685371 TAATTATGGCAGAAGGCAAAGGG + Intronic
1095426011 12:42075400-42075422 TGCTTATGGCTGGTGGAACAGGG - Intergenic
1096616726 12:52837315-52837337 TGGTTAGGGCTGAGGGAACAGGG - Intergenic
1096967562 12:55640334-55640356 TAGTTATGGCTTGTGGAACAGGG + Intergenic
1097483869 12:60168512-60168534 TAGTTATGACTGGTAGAACAGGG + Intergenic
1098996526 12:77126979-77127001 CAGTTATGGCAGCTGAAAGAGGG + Intergenic
1099126162 12:78760943-78760965 TAATTATGGCAGACGGCAAAGGG + Intergenic
1099271770 12:80519871-80519893 TAATTATGGCTTGTGGAACAGGG + Intronic
1100198169 12:92270968-92270990 TAGTTAAGGCAGAAGGCAGAAGG + Intergenic
1100861303 12:98810131-98810153 TAGTTATGGCTGGTGGAGCAGGG - Intronic
1101499374 12:105288233-105288255 GAGTTCTGGCCAATGGAACATGG + Intronic
1102725827 12:115063738-115063760 TAGTCATGGCAGAAGGCAAAGGG - Intergenic
1102760860 12:115383710-115383732 TACTGAGGGCAGATGGAGCAAGG + Intergenic
1106141666 13:27016940-27016962 TAGTTATGGCTGGTGGCACAGGG + Intergenic
1106175316 13:27325317-27325339 TAGTTATGGCTGGTGGAAGGGGG + Intergenic
1106374162 13:29168314-29168336 TAGTTAGGGGCTATGGAACAAGG - Intronic
1106572523 13:30940186-30940208 TAGTCTTGGAAGATGGAAGAAGG + Intronic
1106756511 13:32827635-32827657 TAGCTATGGCACAGGGAACTGGG + Intergenic
1106757214 13:32834868-32834890 TTGTAATAGGAGATGGAACATGG + Intergenic
1107273997 13:38656269-38656291 TAGTTACGGCTAATGGAACAGGG - Intergenic
1108459857 13:50654386-50654408 GAGGAATGGCAGAAGGAACATGG + Intronic
1108956535 13:56165833-56165855 TAATTATGGCAGAAGGCAAAGGG + Intergenic
1109088621 13:58009734-58009756 TAGCTATGGGAGGTGGGACACGG + Intergenic
1109341363 13:61064672-61064694 CAGTTATGGCAGAAGGAGAAGGG + Intergenic
1109805987 13:67443835-67443857 TGGTTATGGCATAAGCAACAAGG - Intergenic
1111208139 13:85039565-85039587 TAGTTATGGCTAGTGGAACAGGG + Intergenic
1112243500 13:97705843-97705865 TAGTTATGGCTTGTGGAACAGGG - Intergenic
1115221630 14:31063804-31063826 TAGTTTTGGCAAATGTACCATGG + Intronic
1115419756 14:33180864-33180886 TAGTGATGACAGATTGAATAGGG + Intronic
1116687066 14:48053140-48053162 TAGTTATGGCTGGTGGAACAGGG + Intergenic
1119050100 14:71358774-71358796 TAGTCATGGCAGAGGGAAGCAGG + Intronic
1119694182 14:76699500-76699522 TAGTTACGGCTTGTGGAACAAGG - Intergenic
1121389064 14:93558779-93558801 CAGTTATGGCACAGCGAACAGGG - Intronic
1121859028 14:97299109-97299131 TACTTTTGGCAGGTGGAACCTGG - Intergenic
1122255006 14:100470172-100470194 AGGTTCTTGCAGATGGAACAAGG + Intronic
1202918723 14_KI270723v1_random:10814-10836 TAGTGATGGCAGAAGGATGAGGG + Intergenic
1202925901 14_KI270724v1_random:23756-23778 TAGTGATGGCAGAAGGATGAGGG - Intergenic
1123399534 15:19970661-19970683 TATTTATGGCTTGTGGAACAGGG + Intergenic
1123864188 15:24500685-24500707 TAGTTATGGCTGGTGGAACGTGG + Intergenic
1123878542 15:24651168-24651190 TAATGATGGCAGATGGAAGATGG + Intergenic
1124856855 15:33397557-33397579 TAGTCATGGCTGGTGGAACAGGG + Intronic
1128172455 15:65524946-65524968 TAGTTATGGCTTGTGGAACAAGG + Intergenic
1128458607 15:67848819-67848841 TAGTTATGTCTTGTGGAACAGGG + Intergenic
1129480994 15:75826139-75826161 TTGTTATGGGAGGTGGGACAGGG + Intergenic
1130083212 15:80753439-80753461 TAGTTTTGACAGATGTATCACGG + Intronic
1131065856 15:89434654-89434676 TAGTTATGGCAAATGTACCATGG + Intergenic
1133025222 16:2986273-2986295 CAGTTATGCCAGATGGGACGAGG - Intergenic
1133496631 16:6324465-6324487 CAGTTATGGCAGAAGGCAGAAGG + Intronic
1133714314 16:8432288-8432310 TAGTTGTGGCTGGTGAAACAGGG + Intergenic
1134891916 16:17848473-17848495 CATTTATGGCAGCTGGATCATGG - Intergenic
1135286980 16:21202079-21202101 TAGTACTGGCAGATGGCACGAGG - Intronic
1135296222 16:21281593-21281615 TAGTTATGGCTGGTGGAACAAGG - Intronic
1136872350 16:33819167-33819189 TAATTATGGCAGAAGGGAAAAGG + Intergenic
1136928220 16:34394996-34395018 TAGTTATGTGAGCTAGAACAAGG - Intergenic
1136976354 16:35016808-35016830 TAGTTATGTGAGCTAGAACAAGG + Intergenic
1137225591 16:46504247-46504269 TATTTTTGGCAGATGCAAAAGGG + Intergenic
1137380975 16:47999449-47999471 CAGTTATGGCTGGTTGAACAGGG - Intergenic
1140539765 16:75746072-75746094 TACTTATGGCTGGAGGAACAGGG - Intronic
1142435741 16:90055876-90055898 CAGTTATGGCAGAAGGCAAAGGG - Intergenic
1203099822 16_KI270728v1_random:1296901-1296923 TAATTATGGCAGAAGGGAAAAGG - Intergenic
1143995437 17:11002723-11002745 TAGTCATGGCTGGTGGAACAGGG - Intergenic
1143996397 17:11010150-11010172 TAGTCATGGCTGATAGAACAGGG - Intergenic
1146775954 17:35616585-35616607 TAGTTTTGGCAAATGTACCACGG - Intronic
1149553506 17:57557140-57557162 AAGGCATGGCAGATGGTACACGG + Intronic
1151163771 17:72187238-72187260 TAGATGTGGCAGATCCAACAGGG - Intergenic
1152792659 17:82290304-82290326 TAGTTACGGCTGGTGGAGCAGGG + Intergenic
1153043346 18:834328-834350 TAGTGATGGCTGGTGGAACGAGG + Intergenic
1153139167 18:1952957-1952979 TAGTTACGGCTTGTGGAACAGGG + Intergenic
1153963476 18:10159908-10159930 TAGTGATGGCTGGTGGAACAAGG + Intergenic
1155844161 18:30684679-30684701 TAGTTATGGCTTTTGGAACAGGG - Intergenic
1156151812 18:34251964-34251986 TAGTTATGGCTGGTGGAACAGGG + Intergenic
1156151822 18:34252082-34252104 TCGTTGTGGCAGTTAGAACATGG + Intergenic
1156406331 18:36786208-36786230 TGGTTATGGCTGATAGAATAAGG + Intronic
1157964733 18:52194962-52194984 TAGTCATGGCAGAAGGCAAAGGG - Intergenic
1158107371 18:53900967-53900989 TAGTTATGTCTGATTGGACAAGG - Intergenic
1158726752 18:59980518-59980540 TAGTTACGGCTGGTGGAACAAGG + Intergenic
1158927648 18:62285368-62285390 TCTTTAGGGCAGATTGAACAAGG - Intronic
1159490840 18:69132367-69132389 TAGATATGTCAGATGAAAAAAGG + Intergenic
1160006785 18:75074120-75074142 CAGTTATGGCAGAAGGCAAAGGG - Intergenic
1163068196 19:14815128-14815150 TAGTTATGGCTGCTGGAATAGGG - Intronic
1163084209 19:14967796-14967818 TAGTTATGGCTGGTGGAACAGGG - Intronic
1164442353 19:28288981-28289003 CAGTTATGGCTGGTGGGACAGGG + Intergenic
1164596238 19:29532242-29532264 GAGTTCTGGCCGATGGAAGAGGG - Intronic
1165943026 19:39424751-39424773 AAGGTGTGGCAGCTGGAACATGG - Exonic
1166255777 19:41603362-41603384 TAGTTGTGGCTGTTGGAACAGGG + Intronic
1167857259 19:52252724-52252746 TAGTTATGGCTTGTGGAACACGG + Intergenic
1168252925 19:55150847-55150869 TAGTTATGCCTTGTGGAACAGGG - Intergenic
1168372424 19:55847622-55847644 TAGTTATGACAAATGTACCATGG - Intronic
925391170 2:3495176-3495198 TAGTTACGGCTGGTGGAACAGGG - Intergenic
925711835 2:6748635-6748657 TAGTTACAGCAGGTGGAACAGGG - Intergenic
925833754 2:7922782-7922804 TAGTTTTGACAAATGGACCACGG + Intergenic
926643196 2:15259672-15259694 TAGTTGTGCAAGTTGGAACAAGG - Intronic
928536787 2:32248924-32248946 TAGTTATGGCAGATGGAACAGGG - Intronic
929498112 2:42464606-42464628 TAGTTGGAGCAGATGGTACAAGG - Intronic
929828255 2:45327433-45327455 TAGTCATGGCATACGGTACAGGG - Intergenic
930969852 2:57382101-57382123 TAGTTATGGCTGGTGAAACAGGG - Intergenic
931526745 2:63164525-63164547 TAGTCATGGCAGAAGGCAAAGGG - Intronic
932181096 2:69646843-69646865 TAGTTATGGTTTGTGGAACAGGG - Intronic
932744035 2:74316778-74316800 TAGTTATGGCTTATGGAGCAGGG - Intronic
933035715 2:77394901-77394923 TAGTTATGGCTTGTGGAACAGGG + Intronic
935432657 2:102993050-102993072 TGGTTATGGCAGAAAGAAAATGG + Intergenic
935521210 2:104107439-104107461 TAGTTAAGGCTGGTGGAAAAGGG + Intergenic
935619191 2:105113810-105113832 TAGTTATGGCTGGTGGAAAGGGG - Intergenic
935665388 2:105507754-105507776 TAGTTAAGGCTGGTGGAACAGGG + Intergenic
935676781 2:105601153-105601175 TAGTTACGGCTGGTGCAACAGGG + Intergenic
935965080 2:108464897-108464919 TATTTATGGCAGAAGGCAAAGGG + Intronic
936264533 2:110992635-110992657 GAGGTAAGGCAGATGGAGCATGG + Intronic
936734093 2:115419368-115419390 CAGTCATGGCAGAAGGAAAAGGG + Intronic
937075509 2:119102843-119102865 TAGATATTGCAGATAGAAAAGGG - Intergenic
939734304 2:145825034-145825056 TAATTATGGCAGAAGGTAAAGGG + Intergenic
941403389 2:165059437-165059459 TATTTGTGGCAGATAGAAGATGG - Intergenic
941987206 2:171521575-171521597 TAGTTCTGGCTGGTGCAACAGGG + Intergenic
942211856 2:173678991-173679013 TAGTTATCTCATATGGAAAATGG - Intergenic
942568077 2:177286260-177286282 TAGTTATGGCTGGTGGAACAGGG - Intronic
943258482 2:185628468-185628490 CATTTATGGCAGAAGGAAAAGGG - Intergenic
943440611 2:187923176-187923198 TAGTTATGGTTAGTGGAACATGG - Intergenic
945863446 2:215149972-215149994 TAGTTATGGCTTGTGAAACAGGG + Intergenic
946495850 2:220194579-220194601 TAGTCATGGCAGAAGGATGAAGG - Intergenic
946897262 2:224337048-224337070 TAGTCATGGCAGAAGGCAAAGGG - Intergenic
947041484 2:225926281-225926303 GAGTGATGAGAGATGGAACAAGG + Intergenic
947888217 2:233593164-233593186 TATTTGTGGCTTATGGAACAAGG + Intergenic
947894447 2:233656394-233656416 TATTTGTGGCTTATGGAACAAGG + Intronic
947964132 2:234264962-234264984 CAGTTATGGCAGAAGGCAAAAGG + Intergenic
1168863222 20:1061199-1061221 TTGCTCTGGCTGATGGAACATGG - Intergenic
1169138210 20:3210441-3210463 TGGCTATGGCTGATTGAACAGGG - Intronic
1169407001 20:5330104-5330126 TAGTTATGGCTTGTGGAATAGGG + Intergenic
1169560273 20:6792498-6792520 TATTTAAGGCATATGAAACAAGG + Intergenic
1169799890 20:9504036-9504058 TAGTTATGGCTGTTGGAACAGGG - Intergenic
1170065876 20:12310035-12310057 CAGTTATGGCAAAAGGATCAAGG - Intergenic
1173098179 20:40058667-40058689 TAATTATGGCAGAAGGCAAAGGG + Intergenic
1173399718 20:42713870-42713892 TAGTCATGGCAGAAGGCAAAGGG - Intronic
1177277862 21:18938853-18938875 TAATTCTGCTAGATGGAACATGG - Intergenic
1177425090 21:20912515-20912537 CAGTCATGGCAGAAGGCACAGGG + Intergenic
1177757832 21:25368715-25368737 TAGTTACGGCTTGTGGAACAGGG - Intergenic
1178345778 21:31826798-31826820 TAGTTACGGCTTGTGGAACAGGG + Intergenic
1179053658 21:37912550-37912572 TGATAATGTCAGATGGAACAAGG + Intronic
1181659429 22:24332555-24332577 TAGATAAGGCAGGTGGAAAAGGG - Intronic
1181740917 22:24920877-24920899 TAGTTTTGGCAAATGTACCAGGG - Intronic
1182815439 22:33158815-33158837 CAGATATGGCAGATAGAATAGGG + Intergenic
1183753532 22:39737156-39737178 TATGTATGGCAGATGCCACATGG - Intergenic
1183837645 22:40469409-40469431 TACTTATGACAGAAGGCACATGG - Intronic
1184887218 22:47353808-47353830 CAGTTATGGCAGAAGGTATAGGG - Intergenic
1184965339 22:47967426-47967448 TTGCTATGGCTGCTGGAACAAGG - Intergenic
952193983 3:31053136-31053158 TAGTCATGGCAGATGAAAGGTGG - Intergenic
952304442 3:32133331-32133353 TAGTAATGACAGATAAAACAAGG - Intronic
953708320 3:45247846-45247868 TAGTCATGGCAGAAGGGAAATGG - Intergenic
955441808 3:58964161-58964183 TAGTTATGACATCTGGAATAAGG - Intronic
955459903 3:59170396-59170418 TAATTATGGCAGAAGGCAAAGGG - Intergenic
956531870 3:70229538-70229560 TAGTTCTGGCTGAAGGGACATGG + Intergenic
957082775 3:75650824-75650846 TAGTGATGGCAGAAGGATGAAGG - Intergenic
957399914 3:79697148-79697170 TTGGGAAGGCAGATGGAACAGGG + Intronic
958515757 3:95113204-95113226 TGGTTATGGCTGATAGAACATGG + Intergenic
958952937 3:100436006-100436028 TAGTAATGGCTGATGGAACAAGG + Intronic
959564686 3:107822404-107822426 TAGTTATGGCTAGTGGAACAGGG + Intergenic
959598088 3:108149368-108149390 CAGTTATGGCAGAAGGCAAAAGG - Intergenic
960462902 3:117958908-117958930 TGGATATAGCAGAAGGAACAGGG + Intergenic
962177027 3:133166043-133166065 TATTTATGGCTGATAGAACAGGG + Intronic
962853533 3:139325384-139325406 TAATTATGGCAGAAGGCAAAAGG + Intronic
963012241 3:140781365-140781387 TAATCATGGCAGATGGCAAAGGG - Intergenic
963357636 3:144230045-144230067 TAATTATGGTAGAGTGAACATGG + Intergenic
963549084 3:146698284-146698306 CAGTTATGGCAGAAGGCAAAGGG + Intergenic
963644390 3:147895509-147895531 TAATTATGGCTTGTGGAACAGGG + Intergenic
964003942 3:151808185-151808207 CAGTGATGGCAGATGGGACCGGG - Intergenic
964012126 3:151903902-151903924 TAGTTCTGGCTTGTGGAACAGGG - Intergenic
964668995 3:159204696-159204718 TCATTATGGCAGATTGAAGATGG - Intronic
964850847 3:161094906-161094928 TAGTTGTAGCAGATGAAAGAGGG - Intronic
966457286 3:180131919-180131941 TGGTGATGGCAGAGGGAAGAAGG + Intergenic
967222381 3:187258210-187258232 CAGTTATGGCTGGTGGAACAGGG - Intronic
967932341 3:194699363-194699385 GAGTTCTGGCCAATGGAACATGG - Intergenic
968640987 4:1714595-1714617 TAGTTATGGCTGGTGGAATAGGG - Intergenic
969827625 4:9770276-9770298 AAGTTATGACAGCTGGATCAGGG - Intergenic
970243388 4:14032667-14032689 TATTTTTGGCATATGGAACTTGG + Intergenic
971666164 4:29488284-29488306 TAGTCATGGCAGAAGGCAAAGGG - Intergenic
971761398 4:30770768-30770790 CAGTTATAACAAATGGAACACGG - Intronic
972922417 4:43960233-43960255 TAGTTATGGCTGGTAGAACAGGG + Intergenic
975496871 4:75045239-75045261 TGGTTATAGCAGAGGGAGCAAGG + Intronic
975974103 4:80075224-80075246 TAGTTATGGCTTGTGGAACAGGG + Intronic
976051685 4:81017561-81017583 TAGTCATGGCAGAAGGCAAAGGG + Intergenic
976798392 4:88959527-88959549 TAATTATAGCAGAAGGAAAAGGG - Intronic
976813477 4:89121259-89121281 TAGTTATGGCTGATGGAACAGGG - Intergenic
976836901 4:89385063-89385085 TTATTCTGGCAAATGGAACAAGG + Intergenic
976883692 4:89961155-89961177 TAGTTATGGCTTGTGGAGCAGGG - Intergenic
977382329 4:96291549-96291571 TAGTTATGGCTTGTGGAACAGGG + Intergenic
977883409 4:102232898-102232920 TAGTTCTAACAGATGAAACATGG + Intergenic
978067071 4:104418264-104418286 GAGTTATGACAGATGGCACTAGG - Intergenic
978493996 4:109339834-109339856 AAGTGATGACAGATGGAAAATGG + Intergenic
978737485 4:112100401-112100423 TAGCTATGGCTGGTGGAACAGGG + Intergenic
979209546 4:118082866-118082888 TAATTATGGCAGAAGGCAAAGGG + Intronic
979446467 4:120819433-120819455 TAGCCATGGCACATGGCACATGG + Intronic
980254416 4:130359329-130359351 TAGATAGGGCAGAGGAAACAGGG + Intergenic
980423472 4:132594136-132594158 TAGTTATGGCCAGTAGAACAGGG + Intergenic
980898391 4:138881056-138881078 CAGTTATGGCAGAAGGCAAAGGG - Intergenic
981072438 4:140558038-140558060 TAGTTATGGCTGGTGGAAAATGG - Intergenic
981103049 4:140851785-140851807 TAGTTATGACAAATGTACCATGG - Intergenic
981674977 4:147332304-147332326 TAGTTTTGGCAGAGTGGACATGG + Intergenic
981682580 4:147416730-147416752 TAGTGATGACAGATGTACCATGG + Intergenic
981850807 4:149228325-149228347 CAGTTATGGTTTATGGAACAGGG - Intergenic
982575445 4:157103314-157103336 TAGTTATGGCTTGTGGAACAGGG + Intronic
982823453 4:159973387-159973409 TAATTATGGCAGAAGGCAAAGGG + Intergenic
983079855 4:163371911-163371933 TAGTTATGGCTGGTGAAACAGGG - Intergenic
983217647 4:165017021-165017043 TAGTGAGGACAGATGGGACAGGG - Intergenic
983716921 4:170793403-170793425 TTTTTCTGGCTGATGGAACAAGG - Intergenic
983794945 4:171850418-171850440 TTGTTATGGCTTGTGGAACAGGG + Intronic
984707570 4:182858917-182858939 TAGTCGTGGCTGGTGGAACAGGG - Intergenic
985178116 4:187225167-187225189 AAGGTCTGGCAGATGGCACAGGG - Intergenic
986253048 5:6078720-6078742 CAGCTATGGCTGCTGGAACAGGG - Intergenic
986481613 5:8194595-8194617 CAGTTATGGCAGAAGGCAAAGGG + Intergenic
986519413 5:8598024-8598046 TAGTTACGGCTGGTGAAACAGGG - Intergenic
986545912 5:8896625-8896647 TGGTTATGGCTGAAGGAAAAGGG + Intergenic
988244833 5:28666594-28666616 TAGTTATGGCTGTTAGAACAGGG + Intergenic
990387692 5:55283374-55283396 TGGTTGTGGCAGGTGAAACAGGG - Exonic
990494490 5:56334196-56334218 CAGTTATGGCAGAAGGCAAAGGG + Intergenic
993331754 5:86608944-86608966 TAATTATGGCAGAAGGCAAAGGG - Intergenic
993816634 5:92556579-92556601 TAGTCATGGCAGAAGGCAAAGGG - Intergenic
994586601 5:101716469-101716491 TAGTTATGGCTGGTGGAACAGGG + Intergenic
995795335 5:115935488-115935510 TAGTTATGGAAGATAGATAAAGG + Intergenic
996362197 5:122662086-122662108 TTGTAACAGCAGATGGAACATGG + Intergenic
996424931 5:123304288-123304310 TAGTTATGGCTTGTAGAACATGG + Intergenic
996785902 5:127236323-127236345 TAGTTATGGCAGAGTGTATATGG - Intergenic
997111146 5:131076022-131076044 TAGCCATGGCAGAAGGAAAAAGG + Intergenic
1001545377 5:172567743-172567765 TATTTATGGCAGAAGGAAAGAGG - Intergenic
1001999308 5:176188640-176188662 TAGTTATGGCTGGTGGAACAGGG + Intergenic
1002049710 5:176563373-176563395 CGGTTATGGCTGGTGGAACAGGG + Intronic
1002840305 6:899708-899730 TAATCATGGCAGAGGGAAAAGGG - Intergenic
1002851315 6:998899-998921 TAGTTCTGGCTGGTGGAACAGGG + Intergenic
1005188978 6:23196407-23196429 TATTTATGGCAGAAGGTAAAAGG - Intergenic
1005221203 6:23590989-23591011 AAGTTGTAACAGATGGAACAGGG - Intergenic
1005461996 6:26078091-26078113 TAGTTTTGGGAGATGGAAGCTGG - Intergenic
1005816533 6:29557306-29557328 TAGTTATGGCTTGTGGAACACGG - Intronic
1006737249 6:36283121-36283143 TAGTGTTGGCAAATGGACCATGG - Intronic
1006779952 6:36625698-36625720 GAGTTATGTGAGATGGAGCAAGG + Intergenic
1009733111 6:67635354-67635376 CAATTATGGCAGAAGGAAAAGGG - Intergenic
1010745150 6:79552226-79552248 TAGTTACGGCTGGTGGAACAGGG + Intergenic
1011623228 6:89262096-89262118 TAGTTATGGCTGGTGGAACAGGG - Intronic
1012074890 6:94670995-94671017 CAATTAGGGCAGATGGATCATGG + Intergenic
1012418281 6:99033802-99033824 TATTTATGGCAGAAGGCAAAGGG - Intergenic
1012449990 6:99344842-99344864 TCGTTCTGGCTGATGGAGCAGGG - Intronic
1012836108 6:104270671-104270693 TAGTTATGGCAAACTGAACTGGG - Intergenic
1012900952 6:105005654-105005676 CAGTCATGGCAGATGGCAAAGGG - Intronic
1013735108 6:113217298-113217320 TAGTTTTGGCAAATGTATCATGG + Intergenic
1013848134 6:114479334-114479356 TGGTTATGGGAGAGGGAACATGG + Intergenic
1014234269 6:118937201-118937223 TATTCATGGCAGATGGCAAAGGG - Intergenic
1016029687 6:139324524-139324546 TGTTTATGGGAGATTGAACAGGG - Intergenic
1016103613 6:140134246-140134268 TAGGTATGGCAGTTGGAGAAAGG + Intergenic
1017557745 6:155590385-155590407 TGGTTTTGCCAGATGGAATATGG + Intergenic
1018420151 6:163634135-163634157 AAGTTATGGAAGAGGGAAGAAGG + Intergenic
1018862011 6:167717821-167717843 GAGACAAGGCAGATGGAACAAGG + Intergenic
1018994584 6:168701314-168701336 TGGTGCTGCCAGATGGAACAGGG - Intergenic
1020527500 7:9281277-9281299 CAATTATGGCAGATGGCAAAAGG - Intergenic
1021399691 7:20195694-20195716 TAGTTATGGCTTGTGGAACAGGG + Intronic
1022457639 7:30572922-30572944 TAGTTATGGAAGAAAGACCATGG - Intergenic
1023360106 7:39406769-39406791 TTTTTATGGCAGATTGAACTCGG + Intronic
1024741474 7:52359744-52359766 TAGTGATGCAAGTTGGAACAAGG - Intergenic
1026271671 7:68842224-68842246 TAGCTATGGCTGATGGAACGGGG - Intergenic
1026315753 7:69225720-69225742 GAGTTATGGCTGGGGGAACAGGG + Intergenic
1026554205 7:71391897-71391919 TAGTTATGGCAGAAGGGAAGGGG + Intronic
1028143603 7:87297983-87298005 CAGTTATGGCAGAAGGCAAAAGG + Intergenic
1031951364 7:127895897-127895919 GAGTTATGTCAGAAGGAACTAGG - Intronic
1035895932 8:3401687-3401709 TTGCTATGGCAGGTGGAAAAAGG + Intronic
1036705607 8:11044060-11044082 TAGTTACAGCTGGTGGAACAGGG - Intronic
1036759239 8:11495829-11495851 TAGTTCTGGCAAATGTACCATGG + Intronic
1036801938 8:11799286-11799308 TAGTTATGGCTGGTGGAACAGGG + Intronic
1037718873 8:21424104-21424126 TTGTTATGGCAGATGGTCCTGGG + Intergenic
1038180696 8:25224613-25224635 TAGTTATGGTTGAGGGAAGATGG + Intronic
1038527646 8:28290491-28290513 TAGTTTTGGCAAATGTACCATGG + Intergenic
1039071030 8:33649499-33649521 TGGTTATGGCTGGTGGAACAGGG + Intergenic
1039800197 8:40947809-40947831 TAGTTATGGCACATGGGACATGG - Intergenic
1040484972 8:47861668-47861690 TTGCTCTGGCAGATGGGACAAGG - Intronic
1040856870 8:51957637-51957659 TAGTTATGGGAGGTTGGACATGG + Intergenic
1041060902 8:54033459-54033481 TATTTATGGCAGAAGGGAGAAGG + Intergenic
1042539432 8:69893329-69893351 GTGTTATGGAACATGGAACATGG - Intergenic
1042887227 8:73565344-73565366 CAGTCATGGCAGATGGCAAAGGG - Intronic
1043334357 8:79155699-79155721 TACTCATGGCAGAAGGAAAAGGG - Intergenic
1044994591 8:97827428-97827450 TAGATATGGGGGAAGGAACATGG - Intronic
1047009891 8:120660855-120660877 TTGTTATGTCACAGGGAACACGG + Intronic
1048040937 8:130728138-130728160 TAGCTAGGGCAGAGTGAACAAGG + Intergenic
1048475751 8:134740988-134741010 TGGTTATGGTAGAGGGAAAAGGG - Intergenic
1052637395 9:31122461-31122483 CAGTCATGGCAGATGGCAAAAGG + Intergenic
1052721060 9:32171536-32171558 TAGTTATGGCTTGTGGAACAGGG + Intergenic
1055051703 9:71987981-71988003 TAGTTGTGGCTGGTGCAACAGGG + Intergenic
1055180320 9:73379329-73379351 TACTCATGGCAGAAGGCACAGGG - Intergenic
1055187945 9:73478647-73478669 GAGTTATGAGAGATGGAACAGGG - Intergenic
1056237508 9:84609836-84609858 TATTTATGGAAAAGGGAACATGG + Intergenic
1056419772 9:86412734-86412756 TAGTAACGGGAGATGAAACATGG + Intergenic
1059462953 9:114446751-114446773 GAGTTAAGGCAGATGGAAGGAGG - Intronic
1060331161 9:122671934-122671956 TAGTTATGGCTGGTGGAACAAGG - Intergenic
1185630083 X:1510442-1510464 TAGTTATGGCTGGTGGAGCAGGG - Intronic
1186943834 X:14542519-14542541 TAGTTATGGTTGATGGAACAGGG + Intronic
1187073579 X:15912248-15912270 TAGTGATAGTAGAGGGAACAGGG + Intergenic
1188857824 X:35219243-35219265 TAGTCATGGCAGAAGGCAAAGGG - Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189178308 X:38980007-38980029 TAGTTCTGGCCAATGGAAAATGG + Intergenic
1189407780 X:40741012-40741034 TAATTCTGGCTAATGGAACATGG - Intergenic
1191022307 X:55875711-55875733 TAATTATGGCAGAAGGCAAAGGG - Intergenic
1193958137 X:87888238-87888260 TAGTTTTGGCAAATGTAACATGG + Intergenic
1193995045 X:88355268-88355290 TTCTTATGGCAGATGGAAAAGGG + Intergenic
1194972326 X:100357833-100357855 GCGTTGTGGCAGATGGCACAGGG - Intronic
1195157056 X:102134089-102134111 TAGTTATGGCTTGTGGAACAGGG + Intergenic
1195240562 X:102947589-102947611 TAGCTATTGCTGGTGGAACAGGG + Intergenic
1195451742 X:105021647-105021669 TAGTTATGGCAAATGAAAATGGG - Intronic
1196358157 X:114819729-114819751 TAGTTATAGCTTGTGGAACACGG + Intronic
1196724464 X:118883852-118883874 TAATCATGGCAGATGGCAAAGGG - Intergenic
1198269193 X:135038205-135038227 TTGTTTTGGCAGAGGGGACAAGG - Intergenic
1198617459 X:138475018-138475040 TAGTTATGACTGCTGGAAGAGGG + Intergenic
1199111462 X:143940406-143940428 TAGTTATGGCTTGTGAAACAGGG - Intergenic
1199613814 X:149639658-149639680 TAGCCATGGCTGGTGGAACAGGG + Intergenic
1199627832 X:149757416-149757438 TAGCCATGGCTGGTGGAACAGGG + Intergenic
1200040416 X:153361933-153361955 TAGTTATGCCTGGTGGAACAGGG - Intergenic
1201274544 Y:12285635-12285657 TAGTGATGGCAGATGGGGCCGGG + Intergenic