ID: 928544392

View in Genome Browser
Species Human (GRCh38)
Location 2:32315632-32315654
Sequence CACTCTCCTGCCTCAGTAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3675
Summary {0: 3, 1: 13, 2: 49, 3: 230, 4: 3380}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928544392_928544395 -10 Left 928544392 2:32315632-32315654 CCAGCTACTGAGGCAGGAGAGTG 0: 3
1: 13
2: 49
3: 230
4: 3380
Right 928544395 2:32315645-32315667 CAGGAGAGTGGCATGAACCCGGG 0: 86
1: 11129
2: 52406
3: 119628
4: 180506
928544392_928544396 -7 Left 928544392 2:32315632-32315654 CCAGCTACTGAGGCAGGAGAGTG 0: 3
1: 13
2: 49
3: 230
4: 3380
Right 928544396 2:32315648-32315670 GAGAGTGGCATGAACCCGGGAGG 0: 59
1: 6712
2: 39618
3: 82815
4: 174575
928544392_928544397 -4 Left 928544392 2:32315632-32315654 CCAGCTACTGAGGCAGGAGAGTG 0: 3
1: 13
2: 49
3: 230
4: 3380
Right 928544397 2:32315651-32315673 AGTGGCATGAACCCGGGAGGCGG 0: 47
1: 4984
2: 31948
3: 62314
4: 116351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928544392 Original CRISPR CACTCTCCTGCCTCAGTAGC TGG (reversed) Exonic
Too many off-targets to display for this crispr