ID: 928549418

View in Genome Browser
Species Human (GRCh38)
Location 2:32356946-32356968
Sequence TCGCGCGTGCCACGCGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928549418_928549430 25 Left 928549418 2:32356946-32356968 CCCGCGGCGCGTGGCACGCGCGA 0: 1
1: 0
2: 0
3: 2
4: 33
Right 928549430 2:32356994-32357016 CGGCCTCCAGCCCGCGCCCCGGG 0: 1
1: 2
2: 4
3: 50
4: 394
928549418_928549423 5 Left 928549418 2:32356946-32356968 CCCGCGGCGCGTGGCACGCGCGA 0: 1
1: 0
2: 0
3: 2
4: 33
Right 928549423 2:32356974-32356996 CCCGCGCATGCTCCACCCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 86
928549418_928549429 24 Left 928549418 2:32356946-32356968 CCCGCGGCGCGTGGCACGCGCGA 0: 1
1: 0
2: 0
3: 2
4: 33
Right 928549429 2:32356993-32357015 CCGGCCTCCAGCCCGCGCCCCGG 0: 1
1: 0
2: 10
3: 41
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928549418 Original CRISPR TCGCGCGTGCCACGCGCCGC GGG (reversed) Intergenic