ID: 928554080

View in Genome Browser
Species Human (GRCh38)
Location 2:32404721-32404743
Sequence GGTGCAGTGAGCCGTGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 951
Summary {0: 1, 1: 0, 2: 6, 3: 73, 4: 871}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928554080_928554081 -10 Left 928554080 2:32404721-32404743 CCGGGCTCACGGCTCACTGCACC 0: 1
1: 0
2: 6
3: 73
4: 871
Right 928554081 2:32404734-32404756 TCACTGCACCCTTTACCTCCTGG 0: 2
1: 294
2: 11587
3: 118772
4: 181589
928554080_928554082 -9 Left 928554080 2:32404721-32404743 CCGGGCTCACGGCTCACTGCACC 0: 1
1: 0
2: 6
3: 73
4: 871
Right 928554082 2:32404735-32404757 CACTGCACCCTTTACCTCCTGGG 0: 3
1: 230
2: 8737
3: 83421
4: 211008
928554080_928554088 30 Left 928554080 2:32404721-32404743 CCGGGCTCACGGCTCACTGCACC 0: 1
1: 0
2: 6
3: 73
4: 871
Right 928554088 2:32404774-32404796 ACCTCAGCCTTCTAAGTAGCTGG 0: 65
1: 3008
2: 40801
3: 235340
4: 300561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928554080 Original CRISPR GGTGCAGTGAGCCGTGAGCC CGG (reversed) Intronic