ID: 928556009

View in Genome Browser
Species Human (GRCh38)
Location 2:32425912-32425934
Sequence CTTTCCCCCACAGCTGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 195}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928556006_928556009 2 Left 928556006 2:32425887-32425909 CCAGCTGCTTCCAGCACATGTGC 0: 1
1: 0
2: 4
3: 22
4: 271
Right 928556009 2:32425912-32425934 CTTTCCCCCACAGCTGTGTCAGG 0: 1
1: 0
2: 1
3: 33
4: 195
928556007_928556009 -8 Left 928556007 2:32425897-32425919 CCAGCACATGTGCCACTTTCCCC 0: 1
1: 0
2: 1
3: 16
4: 212
Right 928556009 2:32425912-32425934 CTTTCCCCCACAGCTGTGTCAGG 0: 1
1: 0
2: 1
3: 33
4: 195
928556000_928556009 25 Left 928556000 2:32425864-32425886 CCTCCTGTCCGCCCTGGCACCAG 0: 1
1: 0
2: 2
3: 20
4: 238
Right 928556009 2:32425912-32425934 CTTTCCCCCACAGCTGTGTCAGG 0: 1
1: 0
2: 1
3: 33
4: 195
928556002_928556009 17 Left 928556002 2:32425872-32425894 CCGCCCTGGCACCAGCCAGCTGC 0: 1
1: 0
2: 2
3: 66
4: 525
Right 928556009 2:32425912-32425934 CTTTCCCCCACAGCTGTGTCAGG 0: 1
1: 0
2: 1
3: 33
4: 195
928556003_928556009 14 Left 928556003 2:32425875-32425897 CCCTGGCACCAGCCAGCTGCTTC 0: 1
1: 3
2: 5
3: 34
4: 340
Right 928556009 2:32425912-32425934 CTTTCCCCCACAGCTGTGTCAGG 0: 1
1: 0
2: 1
3: 33
4: 195
928555999_928556009 26 Left 928555999 2:32425863-32425885 CCCTCCTGTCCGCCCTGGCACCA 0: 1
1: 0
2: 0
3: 24
4: 255
Right 928556009 2:32425912-32425934 CTTTCCCCCACAGCTGTGTCAGG 0: 1
1: 0
2: 1
3: 33
4: 195
928556005_928556009 6 Left 928556005 2:32425883-32425905 CCAGCCAGCTGCTTCCAGCACAT 0: 1
1: 0
2: 0
3: 34
4: 281
Right 928556009 2:32425912-32425934 CTTTCCCCCACAGCTGTGTCAGG 0: 1
1: 0
2: 1
3: 33
4: 195
928556001_928556009 22 Left 928556001 2:32425867-32425889 CCTGTCCGCCCTGGCACCAGCCA 0: 1
1: 0
2: 1
3: 17
4: 250
Right 928556009 2:32425912-32425934 CTTTCCCCCACAGCTGTGTCAGG 0: 1
1: 0
2: 1
3: 33
4: 195
928556004_928556009 13 Left 928556004 2:32425876-32425898 CCTGGCACCAGCCAGCTGCTTCC 0: 1
1: 0
2: 5
3: 47
4: 437
Right 928556009 2:32425912-32425934 CTTTCCCCCACAGCTGTGTCAGG 0: 1
1: 0
2: 1
3: 33
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928556009 Original CRISPR CTTTCCCCCACAGCTGTGTC AGG Intronic
900325700 1:2107787-2107809 ATTTCCCCCAGGGCAGTGTCGGG + Intronic
900609545 1:3538779-3538801 CTTTCCCACCCAGCTGTGCGAGG + Intronic
901458674 1:9378298-9378320 CTGTCCTCCAAAGCGGTGTCTGG - Intergenic
901631296 1:10649428-10649450 CTGTCCCTCACAGATGTCTCAGG - Exonic
902483051 1:16722044-16722066 CCCTCCCCCACAGCTGTTGCTGG + Intergenic
902683722 1:18061906-18061928 CATTCTCCTACAGGTGTGTCTGG + Intergenic
903032309 1:20472718-20472740 CTGTCACCCACAGGTGTGCCCGG - Intergenic
905669698 1:39783439-39783461 CTTTTCCCCAAAGTTCTGTCTGG - Intronic
905972758 1:42153980-42154002 GTTTCCCCATCATCTGTGTCTGG - Intronic
906421122 1:45668129-45668151 CTTTCTCCCACAGCTCTGACTGG + Intronic
909009219 1:70314805-70314827 CTTTCTCCCACAGTTCTTTCAGG + Intronic
914765375 1:150632797-150632819 CTTTTCCCCACAGCTGAGGCAGG - Intergenic
916623396 1:166526517-166526539 CTGTCCTCCACAGCCATGTCTGG - Intergenic
919819737 1:201465585-201465607 CTTCCCCCCACTGCGGTGTTCGG - Exonic
921068797 1:211642211-211642233 ATTTCACCCACAGCTGTGTGTGG - Intergenic
921342340 1:214146613-214146635 CTCACACCCACAGCTGGGTCAGG + Intergenic
922956030 1:229601389-229601411 CTTTGGCCCACAGCTTTTTCAGG + Intronic
1065046315 10:21750241-21750263 CTTGCCCTCACAGCCTTGTCAGG - Intergenic
1065445119 10:25790400-25790422 TTTTTCCCCACAGTTGTGTCTGG + Intergenic
1069452716 10:68530029-68530051 GTCTACCCCACTGCTGTGTCCGG + Intergenic
1069531877 10:69225714-69225736 CTTTGGCTCACAGCTCTGTCGGG - Intronic
1075444247 10:122502880-122502902 CTTTTCCCCCCAGCAGTGTGAGG + Intronic
1075639640 10:124055671-124055693 ATTTTCCCCACAGCTGCGCCAGG - Intronic
1076881948 10:133243903-133243925 CTTTCCCACACTTCTTTGTCAGG - Intergenic
1077663322 11:4088126-4088148 TTTTCTTCCACAGCTTTGTCTGG + Intronic
1081491991 11:43576486-43576508 CCTCCCCCCACAACTATGTCTGG + Intronic
1081794885 11:45812251-45812273 CCTTCCACCCCAGCTGTGTCTGG + Exonic
1083091261 11:60201506-60201528 CTTTGCCCCACCGCCCTGTCTGG - Intronic
1083390035 11:62342079-62342101 ATTTACCCTACTGCTGTGTCCGG + Intronic
1083603275 11:63961858-63961880 CCGCCCCCGACAGCTGTGTCTGG + Intergenic
1084498360 11:69519156-69519178 CTTGCCCCCACACCATTGTCAGG - Intergenic
1084659669 11:70539418-70539440 CTTTCCCCCGCAGATCTGTTGGG - Intronic
1087046497 11:93847931-93847953 CTCTCCCTCCCAGCTGTGTGAGG - Intronic
1088221265 11:107572143-107572165 CTTTCCCCACCATCTGTTTCTGG + Intergenic
1090136577 11:124205613-124205635 CTTTCCCCCACAGCACTATGGGG - Intergenic
1092151724 12:6253554-6253576 CCTGCCCCCAGAGCTGTGTTGGG - Intergenic
1094458961 12:30672450-30672472 CTCTCCCCCACTGTTGTGTAGGG - Intronic
1095789226 12:46146024-46146046 CTTTCCCGCACAGCAGTCACAGG - Intergenic
1096695220 12:53344659-53344681 ATCTCCCCCACAGCTGTGGCTGG - Intronic
1096778038 12:53975532-53975554 CTGGCCCCCACCGCTGTGGCCGG + Exonic
1102954827 12:117052675-117052697 CTTTCAACGACAGCTCTGTCAGG + Intronic
1103316676 12:120061835-120061857 CCTTCCAGCACTGCTGTGTCGGG - Intronic
1103481515 12:121253048-121253070 GTTTCCTCCACAGGTGGGTCAGG - Intronic
1103870760 12:124089920-124089942 TTTTCTCCCATAGGTGTGTCTGG - Intronic
1104682689 12:130762270-130762292 CCTTCCGCCACAGCTCTGCCTGG + Intergenic
1104928776 12:132327691-132327713 CTTTCCCGCAGAGCTGTGCTTGG - Intronic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1107453906 13:40536943-40536965 CTTTGCCCCTGAGTTGTGTCAGG - Intergenic
1111740322 13:92197053-92197075 CTATCCCCCACTGCTGTCTGTGG - Intronic
1112712461 13:102145692-102145714 TTTTCCCCAACAGCTATGTTAGG + Intronic
1113471023 13:110546382-110546404 CTTTCCCTCACAGCTGTATTTGG - Intronic
1113668673 13:112160061-112160083 CTTTCTCCCACAGCCATATCTGG + Intergenic
1113723512 13:112579580-112579602 CTCTCCCACACTGCTGTGTGCGG + Intronic
1113723534 13:112579672-112579694 CTCTCCCACACTGCTGTGTGCGG + Intronic
1113927702 13:113950727-113950749 CTTTCTCCCACAGCTGGGTCTGG + Intergenic
1114647429 14:24263450-24263472 CTTCCACCCACAGCCCTGTCTGG + Intronic
1114648954 14:24271211-24271233 GCTCCGCCCACAGCTGTGTCCGG + Exonic
1114649723 14:24276900-24276922 CTTTTACCCATACCTGTGTCTGG - Intergenic
1114652428 14:24293976-24293998 CTTTCCCCCACTGATTTGACAGG - Intronic
1114774573 14:25466626-25466648 CTTTCCCCCACATCTCTGCCTGG - Intergenic
1115030350 14:28786365-28786387 TTTTCCCCCACACCTGTTTTGGG - Intronic
1115853077 14:37602735-37602757 CTCTCCCCCACCGCGGTGACTGG - Intronic
1117024748 14:51608073-51608095 CTCTCCCACACAGCTTTTTCTGG + Intronic
1118933916 14:70268728-70268750 CATTCCCCCACAGATTTCTCAGG - Intergenic
1118955553 14:70477572-70477594 CTCTGCCCCACCGCCGTGTCTGG + Intergenic
1119929219 14:78528470-78528492 ATTTTCCCCACAACTGTGTGAGG + Intronic
1122851717 14:104536893-104536915 CTGAGCCCCACAGCTGTGTGTGG - Intronic
1129614976 15:77091266-77091288 ATTATCCCCACAGCTGTGTTTGG + Intergenic
1131766440 15:95680956-95680978 CTTCCCCCCACCTCTCTGTCTGG + Intergenic
1132215551 15:100059090-100059112 AGTGCCCCCACAGCTGTGTGTGG - Intronic
1132639171 16:970005-970027 CTTCACCCCACAGCTGTGCGGGG - Intronic
1134142300 16:11731364-11731386 CTTTCCCCTCCAGTTGTGCCTGG + Intronic
1134305344 16:13027039-13027061 CCCTCCCCCACTGCTGTATCTGG + Intronic
1136008076 16:27344802-27344824 CTGGGCCCCACAGCTGTGTCCGG - Intronic
1136713576 16:32259421-32259443 CTTTCCACCACAGCTGGGCCTGG - Intergenic
1136754335 16:32670010-32670032 CTTTCCACCACAGCTGGGCCTGG + Intergenic
1136813778 16:33200355-33200377 CTTTCCACCACAGCTGGGCCTGG - Intronic
1136820254 16:33310435-33310457 CTTTCCACCACAGCTGGGCCTGG - Intergenic
1136826817 16:33366974-33366996 CTTTCCACCACAGCTGGGCCTGG - Intergenic
1136831883 16:33465745-33465767 CTTTCCACCACAGCTGGGCCTGG - Intergenic
1137042796 16:35628798-35628820 CTTTCCCCCACAGTTGTTTTAGG - Intergenic
1139442801 16:66977274-66977296 TTTTCCCCAACCTCTGTGTCTGG - Intergenic
1139922069 16:70466869-70466891 CTTCCCCCCACAGCTGGGCCCGG + Exonic
1140450664 16:75068458-75068480 CTTTCTCCCACAGCAGAGTCGGG + Intronic
1141331879 16:83118144-83118166 ATTCCCCCCACAGCAGTCTCCGG - Intronic
1202992354 16_KI270728v1_random:23329-23351 CTTTCCACCACAGCTGGGCCTGG - Intergenic
1203056482 16_KI270728v1_random:930341-930363 CTTTCCACCACAGCTGGGCCTGG + Intergenic
1142597516 17:1036685-1036707 CACTCCCCCACAGCTGTCCCCGG - Intronic
1142676404 17:1516311-1516333 CCTTCTCCCACGCCTGTGTCAGG - Intronic
1142875007 17:2846834-2846856 CTTTGCACCACAGCTGTTTGGGG + Intronic
1145005563 17:19335885-19335907 CATTCCCCCAATCCTGTGTCTGG + Exonic
1145912554 17:28551122-28551144 CTCCCCTCCACAGCTCTGTCTGG + Intronic
1147760605 17:42795356-42795378 CTCTCCACCTCAGCTGTGTGGGG - Exonic
1148221849 17:45868530-45868552 GTCTCCCCCACAGCTGGCTCTGG + Intergenic
1148389067 17:47257246-47257268 CTTTCCCCCACATATGTGAGAGG + Intronic
1148851426 17:50557340-50557362 CCCTCCCCCACAGCTGCGCCTGG - Intergenic
1150516334 17:65813537-65813559 CTTTCTCCAACACCTATGTCAGG - Intronic
1152532912 17:80930822-80930844 CTTCCTCCCACAGCTGGGGCAGG + Intronic
1152549176 17:81020867-81020889 CTTTGCTCCACAGCTGAGGCTGG + Intergenic
1157144890 18:45152053-45152075 GTTTGCCCTTCAGCTGTGTCTGG + Intergenic
1157259609 18:46166758-46166780 CTTTCAGCCACACCTGAGTCTGG - Intergenic
1157525191 18:48375216-48375238 GTTTCCCCCACATCTGGGTTGGG - Intronic
1163875134 19:19861397-19861419 CTTTCTCCCAGAGCTGAGCCAGG + Intergenic
1164590690 19:29505245-29505267 CTTGTCCCCTCAGCTGTGGCTGG - Intergenic
1168290642 19:55355364-55355386 CTGTCCCCCAAAGCTCTCTCTGG - Intronic
1168400524 19:56083752-56083774 CCCACCCCCACAGCTGAGTCTGG - Intergenic
925015913 2:523970-523992 ATTTCACCCCCAGCTGTGTGGGG - Intergenic
925411778 2:3643714-3643736 CCTTACCCCACAGCTGTCGCCGG + Exonic
925836223 2:7949682-7949704 CTTCCCTGCACTGCTGTGTCTGG - Intergenic
927198025 2:20561313-20561335 CTGTCCCCAACAGCTGACTCAGG + Intronic
927263385 2:21117250-21117272 CCTTCCCACACAGCTCTTTCTGG - Intergenic
927954795 2:27200846-27200868 CTGTCCCACACGGCTGTCTCAGG - Intronic
928556009 2:32425912-32425934 CTTTCCCCCACAGCTGTGTCAGG + Intronic
929235934 2:39605588-39605610 CTTTCCCACACAGCTCTCCCAGG - Intergenic
929688145 2:44052213-44052235 CTTTCATCCATAGCTGTGCCTGG - Intergenic
930396418 2:50828584-50828606 CTTTGCCCCACCGCCCTGTCTGG - Intronic
930923126 2:56782147-56782169 TTTTGCCCCACACCTGTGTCTGG - Intergenic
932565045 2:72900886-72900908 CTTTCTCCCACATCCATGTCTGG - Intergenic
933385160 2:81601184-81601206 CTTTCACTCACAGATGTGTCAGG + Intergenic
937338759 2:121077607-121077629 CTGTCCACCCCAGCTGTGTGAGG + Intergenic
937845398 2:126573575-126573597 CTTTGCCCCAGTGCAGTGTCTGG + Intergenic
941395739 2:164970501-164970523 CTTCCCACCACATCTGGGTCAGG - Intergenic
944899160 2:204196790-204196812 CTTTCCAGGACAGGTGTGTCTGG - Intergenic
945672488 2:212819020-212819042 CTTTGTCCCACAGCTGTCTGGGG - Intergenic
948253485 2:236549741-236549763 CTGCCCTCCATAGCTGTGTCAGG + Intergenic
948505350 2:238424109-238424131 TTAACCCCCACAGCTGTCTCCGG - Intergenic
948850182 2:240701939-240701961 CCTTCCCCAACAGGTGTGGCGGG - Intergenic
948907256 2:240985857-240985879 CTGCCCCCCACAGCAGGGTCTGG + Intronic
1169138092 20:3209747-3209769 CTTTTCCACACAGCCGGGTCAGG - Intronic
1170248383 20:14249893-14249915 CTATCCCCCACCCCCGTGTCTGG - Intronic
1170643339 20:18175428-18175450 CTCTGCCCCACAGATGGGTCAGG - Intronic
1172304551 20:33871758-33871780 CTTGATCCCCCAGCTGTGTCGGG + Intergenic
1173975838 20:47186009-47186031 CGTTCCCCCACATCTTTGCCAGG + Intronic
1174113166 20:48210243-48210265 CTCTCCCCTGCAGCTGTGGCTGG + Intergenic
1175079958 20:56411179-56411201 CTATCCCCCACAGCTGGTTGGGG + Intergenic
1178362659 21:31962274-31962296 CCTTTTCCCACAGCTGTGTGGGG - Intronic
1179970053 21:44831177-44831199 TTTTCCCCCACAGGTGTCTGGGG - Intergenic
1180945148 22:19688585-19688607 CCTTCCCCAACAGCTCTGCCTGG + Intergenic
1181344876 22:22211697-22211719 ATTTCCCCCACTCCTGTGGCTGG - Intergenic
1181624164 22:24111843-24111865 TTTTGCTCCTCAGCTGTGTCAGG + Intronic
1182299320 22:29329026-29329048 CTTTACCTCACATCTGTGCCAGG - Intronic
1182709060 22:32309229-32309251 CTTTCCCTCTCATCTGTGTATGG - Intergenic
1183180759 22:36258147-36258169 CGTCCCCCCCCAGCTGTGTTAGG + Intronic
1183431161 22:37766523-37766545 CCTTCCCCCTCAGCAGAGTCTGG + Intronic
1183737769 22:39653418-39653440 ATTTCCCGCAGAGCAGTGTCTGG - Intronic
1184302308 22:43568892-43568914 CTTTCAAACACAGCTGTGTCAGG - Intronic
1185133188 22:49052174-49052196 CTTTTCCCCACAGAGGTGCCGGG + Intergenic
1185154871 22:49187510-49187532 CTTTCTTTCACAGCTGTGTGGGG - Intergenic
1185367215 22:50442178-50442200 CCTTCCCCCACAGGTGGGGCAGG + Intronic
949926964 3:9049175-9049197 CTTTCCCCCATAGCTGTCAATGG - Intronic
956412863 3:68996560-68996582 TTTGCCAACACAGCTGTGTCAGG + Intronic
959345612 3:105191198-105191220 CTTTCCCCCCCAGTGGTGCCTGG - Intergenic
961367934 3:126413251-126413273 CTTGTCCCCGCAGCTGTGCCAGG + Intronic
962240691 3:133748401-133748423 CTCTCCCCCAGGGCTGTGTCTGG + Exonic
966133340 3:176669748-176669770 CTATCCCCCAGAGCTGTATCTGG + Intergenic
966948948 3:184798405-184798427 CAATCGCCCACAGCTGTGCCTGG + Intergenic
969594945 4:8143535-8143557 CCTTCTCCCACTGCTTTGTCTGG + Intronic
969870082 4:10099130-10099152 CTGTGCCCCACAGATGTGTCTGG - Exonic
970870527 4:20812016-20812038 TTTTCCCCCACTGGGGTGTCTGG + Intronic
971660691 4:29410981-29411003 ATTTCCCCTACAGCAATGTCTGG + Intergenic
972801984 4:42486140-42486162 GTTCACCCCACCGCTGTGTCCGG + Intronic
975356220 4:73407894-73407916 CTCTCCCTCACAGCAGAGTCAGG + Intronic
975652746 4:76610861-76610883 CTTAACCCCCCAGCTGGGTCTGG - Intronic
981660269 4:147158329-147158351 CTCTGCCCCAGAGCTGTGCCTGG + Intergenic
985671066 5:1206900-1206922 CCTTCAGCCACAGCTGTGTTTGG + Intronic
985707955 5:1412471-1412493 TGTTCCCCCACAGCTCTCTCGGG + Intronic
986279904 5:6314435-6314457 CTTTCCCCCTGAGCTCTCTCAGG + Intergenic
986491580 5:8296639-8296661 CATTCCCACCCAGCTGTGTAAGG + Intergenic
992185925 5:74244633-74244655 CTTGACCCCACATCTCTGTCAGG + Intergenic
992442940 5:76812245-76812267 CTTTGCCCCACCGCCCTGTCTGG + Intergenic
996339609 5:122421899-122421921 CTTTCACCTCCAGGTGTGTCTGG + Intronic
996457637 5:123702936-123702958 CTCTAGCCCACATCTGTGTCAGG + Intergenic
996787644 5:127257394-127257416 CCTTCCCCCAAAGCCCTGTCTGG - Intergenic
998856795 5:146401642-146401664 CTTTCACCCACAGATGTGGTGGG - Intergenic
1001247895 5:170118785-170118807 CTTGCCCCCTCACCTGTGACAGG - Intergenic
1002050252 5:176566545-176566567 CATGCCCCCACAGCTCCGTCCGG - Intronic
1002133828 5:177096501-177096523 CATTCCCCAACAGCTGTGGTGGG + Intronic
1003124848 6:3348060-3348082 GTGTCCCCCACAGCTGGGACAGG - Intronic
1003147292 6:3519063-3519085 CTCTCCTCCTCAGCTATGTCTGG + Intergenic
1003364262 6:5457388-5457410 CCTTCCCCCGCAGCTGTGGATGG - Intronic
1003423501 6:5979732-5979754 CTTTCACTCACGGGTGTGTCGGG - Intergenic
1003520829 6:6857076-6857098 CTTTCCTCCACAGCTGTACCGGG - Intergenic
1004717761 6:18234658-18234680 CTTTCCCCTCCAGTTGTATCTGG + Intronic
1006502364 6:34466742-34466764 CCTTCCCCCACAGCTGGGATGGG + Intronic
1007479469 6:42140898-42140920 CTTGCCTGCACACCTGTGTCTGG + Intronic
1012130792 6:95489666-95489688 CTTTGTGCCACAGCTGAGTCTGG - Intergenic
1012158137 6:95846899-95846921 CAATCCCACACAGCTGTTTCAGG - Intergenic
1013066373 6:106688005-106688027 CTTTCACCCTCAGCTGTGCCTGG + Intergenic
1013839716 6:114376996-114377018 CTCTCCCGCACTGCTGTGTTGGG + Intergenic
1016252067 6:142055630-142055652 TTTTCCCCCACAGCTCTGTTAGG + Intergenic
1019390118 7:782047-782069 CTTCCCCGCGCAGCTGCGTCCGG + Intronic
1020017693 7:4841106-4841128 CCTTCACCCACAGCAGGGTCTGG - Intronic
1020272494 7:6605645-6605667 CCTTCCCCAACAGCAGTGCCAGG - Intronic
1021061569 7:16118914-16118936 CTTTCTCCCTCAGCTGAGTAAGG - Intronic
1021672514 7:23046729-23046751 CTTTGCCCCACTGCCCTGTCTGG - Intergenic
1029970124 7:104780449-104780471 CCTTCTCCCACAGCTTTGTAAGG + Intronic
1031810562 7:126362694-126362716 CCTTCCCCCACATCTTTGTCTGG - Intergenic
1032493866 7:132346095-132346117 CTTTAGCCCACAGCTGTCTGCGG - Intronic
1032494083 7:132347965-132347987 CTTTCTCCCACAGCTGTCCCAGG - Intronic
1032533127 7:132638149-132638171 CTTGCACACACAGCTGTGTAGGG - Intronic
1034276540 7:149826333-149826355 CTACCCCCCACAGCTGGGGCAGG - Intergenic
1034306170 7:150047169-150047191 CTCTCCCTCCCACCTGTGTCTGG - Intergenic
1034344832 7:150379598-150379620 CCTTTCCCCTCGGCTGTGTCGGG - Intronic
1034800675 7:154053482-154053504 CTCTCCCTCCCACCTGTGTCTGG + Intronic
1035352851 7:158258611-158258633 ATCTCCCCCAAAGCTGTGACTGG - Intronic
1035688944 8:1547383-1547405 GTCAGCCCCACAGCTGTGTCTGG + Intronic
1040422218 8:47251412-47251434 CTTTACTCCATAGCTGTGTCAGG - Intergenic
1041149582 8:54917298-54917320 CTTTTCCCCACAGCTCTCCCAGG + Intergenic
1042387921 8:68199195-68199217 CTTTCTCTCACACCTGTGTGGGG - Intronic
1043443376 8:80296720-80296742 CTTTCCCCCAACCCTGTGACAGG - Intergenic
1044580375 8:93820180-93820202 CTTTCCCCCATGGCTGTGCATGG + Intergenic
1049661796 8:143822885-143822907 CTGTCCCTCAAGGCTGTGTCTGG - Intronic
1050598222 9:7225199-7225221 GTTTCTCCCACAGCTGTGCAAGG + Intergenic
1055375488 9:75645319-75645341 CTTTCTCTGCCAGCTGTGTCTGG + Intergenic
1057262852 9:93595541-93595563 CATTGGCCCAAAGCTGTGTCTGG + Intronic
1057529050 9:95827811-95827833 CCTTCCCCGACTGCTGTGCCTGG - Intergenic
1059477805 9:114561830-114561852 CTTTCACCCTCCCCTGTGTCTGG + Intergenic
1061509381 9:131051106-131051128 CTGTCCACCAAAGCTGTGGCGGG + Intronic
1186275656 X:7935486-7935508 CTTTCCCACCCAACTGTCTCTGG - Intergenic
1189966819 X:46382180-46382202 TTCTCCCCCACAGCAATGTCCGG - Intergenic
1190194119 X:48302887-48302909 CATTACCCCACAGCTATGTTAGG + Intergenic
1190479900 X:50865810-50865832 CTTCCCCCTGCAGCTCTGTCAGG + Intergenic
1190655595 X:52609819-52609841 CATTACCCCACAGCTGTGTTAGG + Intergenic
1190666790 X:52703768-52703790 CATTACCCCACAGCTATGTTAGG + Intronic
1190672628 X:52754640-52754662 CATTACCCCACAGCTATGTTAGG - Intronic
1192203342 X:69081055-69081077 CAAACCCCCACAGCTCTGTCTGG + Intergenic
1195098827 X:101533146-101533168 CTTCCCTCCAAAGCTGTGCCAGG - Intronic
1197920559 X:131589163-131589185 CTTTCTCCCACATCTCTGCCTGG + Intergenic
1198666797 X:139033104-139033126 CTTTTCCCCTCAGCTCTGTGAGG + Intronic
1199972851 X:152873381-152873403 CTGTCCCCCACAGGTCTCTCTGG + Intergenic