ID: 928561836

View in Genome Browser
Species Human (GRCh38)
Location 2:32496517-32496539
Sequence CTGTATGAACAAATGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928561836 Original CRISPR CTGTATGAACAAATGAGGCT GGG (reversed) Intronic
901522725 1:9797703-9797725 CTGAAGGAACAGAGGAGGCTTGG + Intronic
901895467 1:12308128-12308150 CTGTGACAACAACTGAGGCTGGG - Intronic
902212277 1:14912674-14912696 CTTTTTGAAAAAATTAGGCTGGG - Intronic
902329785 1:15725602-15725624 CTGGATGAACAGCTGATGCTGGG - Intronic
903113623 1:21159737-21159759 CTGGAAGATCAACTGAGGCTGGG + Intronic
903301352 1:22380640-22380662 CTGTGTGGAGAAAAGAGGCTTGG + Intergenic
903999807 1:27332462-27332484 CTTTGGGAACAAATGAGGCATGG + Intronic
906376444 1:45300380-45300402 CTGGATGAACACACCAGGCTGGG + Intronic
907452601 1:54556041-54556063 CTGTATAAAAAAATCAGGCCAGG - Intronic
908073254 1:60486965-60486987 TTTTTTGAACAAATGATGCTTGG + Intergenic
911000033 1:93154940-93154962 CTTAATTAAAAAATGAGGCTGGG + Intronic
914783988 1:150811784-150811806 CTGTCTGAAAATTTGAGGCTGGG - Exonic
915949569 1:160179654-160179676 CTGAATGAACAAATGAGTGAGGG - Intronic
916842375 1:168613685-168613707 CTCTAAGAACAAATCAGCCTGGG + Intergenic
918652450 1:186982597-186982619 CTGAATGAACAAATGAAGGTAGG + Intronic
920065182 1:203264222-203264244 CTGTAGGAATAATTGAGGCCTGG + Intronic
920074246 1:203325316-203325338 CTGTGTGACCAAAGGAGGCGGGG - Intergenic
920524095 1:206653311-206653333 TTGAAAGAAAAAATGAGGCTGGG - Intronic
920821112 1:209381894-209381916 ATGAAAAAACAAATGAGGCTGGG - Intergenic
922529333 1:226331463-226331485 CTTTAAAAAAAAATGAGGCTGGG - Intergenic
923641586 1:235767076-235767098 CTGTCTGGAATAATGAGGCTTGG + Intronic
923875712 1:238044697-238044719 CTTTTTCAACAAATGATGCTGGG + Intergenic
1065783755 10:29194063-29194085 CTCTTTGAAAAAATGAGGCCGGG + Intergenic
1065914287 10:30339632-30339654 CTGTAAGTACAAATGGGGCATGG + Intronic
1068162748 10:53287546-53287568 CTGTATGAACAATGTAGGGTAGG - Intergenic
1068224441 10:54088766-54088788 TTGTTTCAACAAATGAAGCTGGG - Intronic
1068446492 10:57131032-57131054 CAGTATGAAGAAATCTGGCTGGG - Intergenic
1070838074 10:79463897-79463919 CTGTGAGAACAAATGAGGTAAGG - Intergenic
1071040225 10:81299638-81299660 CCTTATCAACAAATGATGCTGGG - Intergenic
1072254657 10:93609802-93609824 AAGAATGAACAAATGAGGCCAGG + Intergenic
1073807066 10:107109355-107109377 GTGTATGAGTAAAGGAGGCTTGG - Intronic
1074700289 10:116086562-116086584 CTTTTTGCACAAATGAGGCAGGG - Intronic
1075479713 10:122769447-122769469 TTGCATGAATAAATGATGCTGGG - Intergenic
1076984862 11:228107-228129 CTGTAGGAACAGAGTAGGCTGGG - Intronic
1078881116 11:15449770-15449792 CTGTTGGAAAAAATGAGACTTGG + Intergenic
1079671031 11:23171458-23171480 CGATATGAACAAATGAGCTTTGG - Intergenic
1080344611 11:31310601-31310623 GTGTAAGAACTACTGAGGCTGGG - Intronic
1081392302 11:42543168-42543190 ATGGAAGCACAAATGAGGCTGGG - Intergenic
1081506784 11:43725813-43725835 GAGTTTGAATAAATGAGGCTAGG + Intronic
1084071888 11:66742110-66742132 TTGTATGAATAAATCAGGCATGG - Intergenic
1084589486 11:70082183-70082205 GTGAATGAACAACAGAGGCTGGG - Intronic
1085361379 11:75890763-75890785 CTGTAGGAAGAAAGGGGGCTAGG + Intronic
1091094412 11:132806157-132806179 CTGGATTAACATAGGAGGCTGGG + Intronic
1091559906 12:1604168-1604190 CTGTCTGAAAGAAGGAGGCTGGG + Intronic
1091613490 12:2031501-2031523 TTGTTTGAACAAAAGAGGATTGG + Intronic
1092387450 12:8047103-8047125 CTCTATAAACAAATGTAGCTTGG - Intronic
1093625492 12:21341927-21341949 GTGTATGTATAAATGAGGCATGG + Intronic
1098520890 12:71434381-71434403 CTCTATTAACAAATGGTGCTGGG + Intronic
1098939387 12:76517618-76517640 TGCTATGAAGAAATGAGGCTGGG + Intronic
1099194518 12:79599522-79599544 CAGTATCAACAAATGTGGTTTGG - Intronic
1100179445 12:92069603-92069625 CTGGTTGAACAAATGAGGGATGG - Intronic
1106004188 13:25753195-25753217 CTGTATGAGCAAAAGTGGCAGGG + Intronic
1106381873 13:29247173-29247195 CTTATTCAACAAATGAGGCTGGG + Intronic
1106858987 13:33884558-33884580 CTTTATGAACAAAACAGGGTTGG - Intronic
1107272472 13:38636111-38636133 CTGTAACAACAACTGAGTCTTGG + Intergenic
1107765821 13:43733417-43733439 CTCTATGCACAAATGAATCTTGG + Intronic
1109990588 13:70050460-70050482 CTTTATGAAGAAATGAGTATGGG - Intronic
1110230851 13:73165788-73165810 CTGTATCTAAAAATAAGGCTAGG - Intergenic
1115794672 14:36921303-36921325 CTGTATGAACAAATGAACTATGG - Intronic
1117307410 14:54489848-54489870 TTGTATGGAGAAAAGAGGCTGGG - Intergenic
1118375255 14:65171191-65171213 CCGTCTGAACAAATGAGGAGAGG + Intergenic
1119433546 14:74583705-74583727 ATGGATAAATAAATGAGGCTAGG - Intronic
1120132745 14:80825719-80825741 CTGTATGAAAAAATGAATTTTGG - Intronic
1120592687 14:86394667-86394689 ATTTATAAACAAAAGAGGCTGGG + Intergenic
1125277590 15:38009781-38009803 CTGTATATATAAATGAGGCATGG + Intergenic
1126289918 15:47062754-47062776 CCTTATGAACAAATGAAGTTGGG + Intergenic
1129413760 15:75363508-75363530 TTGAAAGAATAAATGAGGCTGGG + Intronic
1132767861 16:1543644-1543666 CTGTAAGAACGAATGAGACAGGG + Intronic
1133480913 16:6169722-6169744 CTGTAACAACAACTGAGTCTTGG - Intronic
1135074357 16:19380766-19380788 CAGAATGAGCACATGAGGCTGGG + Intergenic
1135527318 16:23223715-23223737 AGGTATGAGCAGATGAGGCTGGG - Intergenic
1137963003 16:52903590-52903612 ATATATGAACAGATGAGGATAGG - Intergenic
1137970192 16:52976987-52977009 CTGTATGAGAACATGATGCTGGG + Intergenic
1138235698 16:55380446-55380468 ATGAATGAACAAATGAGACCTGG - Intergenic
1138298862 16:55909959-55909981 CTGGATGACCAACTCAGGCTGGG - Intronic
1138918681 16:61500129-61500151 CTGCATGAAAAAAGGGGGCTGGG + Intergenic
1139439832 16:66960792-66960814 GTGTGTGAAAACATGAGGCTTGG - Intergenic
1139511922 16:67432467-67432489 CTGTGTGATCAGATGGGGCTGGG + Intronic
1139746174 16:69076385-69076407 ATGTATCAAGAAATGAGGCTGGG - Intronic
1139959917 16:70711523-70711545 CTGTTTGAACAGAGGAGGCCAGG - Intronic
1140883293 16:79218923-79218945 CAGTATGAACCACAGAGGCTTGG - Intergenic
1141290532 16:82714415-82714437 CTGTAAGAAGAAAAGAGGGTCGG + Intronic
1144628161 17:16855934-16855956 CTTTAAAAACAAATCAGGCTGGG - Intergenic
1145873034 17:28291872-28291894 CAGTTTAAACAAATAAGGCTTGG + Intergenic
1146649690 17:34598942-34598964 CTGAATGAATATCTGAGGCTGGG - Intronic
1147057504 17:37845672-37845694 CTGTCTTAACAAAAGAGACTTGG + Intergenic
1148234287 17:45957444-45957466 CTGTCTGATCAAAAGAGGCTTGG + Intronic
1149818887 17:59755046-59755068 CTGTATGATCAAAAGTTGCTTGG + Intronic
1149956340 17:61054880-61054902 CTGGATTAACAAATTTGGCTGGG + Intronic
1150973630 17:70058948-70058970 GTTAATGAACAAATGAAGCTGGG + Intronic
1151563524 17:74883961-74883983 ATGAAAGAACAAATGGGGCTGGG - Intronic
1155484251 18:26324722-26324744 CTGTATTAACAAATGAGTGTAGG - Intronic
1156232825 18:35171437-35171459 CTCTAGGAAGAAATGAGGCTGGG - Intergenic
1156556965 18:38078640-38078662 CTGAATGAATAAAGAAGGCTGGG + Intergenic
1156684579 18:39629188-39629210 CTGTAAGAACAAAGGAATCTGGG - Intergenic
1156928353 18:42610669-42610691 ATGTATGGAAAAATGAGGATAGG - Intergenic
1156954435 18:42944209-42944231 TGGTATGAGCAAGTGAGGCTCGG - Intronic
1157299109 18:46466959-46466981 CTGGAAGAACACTTGAGGCTAGG + Intergenic
1158004954 18:52661639-52661661 CTGTGTGCACAAGTGGGGCTGGG - Intronic
1159928529 18:74290543-74290565 CTGTTTTAAAAAATGAGGCTGGG - Intronic
1160550137 18:79689488-79689510 CCGTAAGAACAAATAAGGCCAGG + Intronic
1161135065 19:2614736-2614758 CTGTATGAACATTTGTGGCAAGG + Intronic
1161862846 19:6811329-6811351 TTGAATAAATAAATGAGGCTGGG - Intronic
1162633555 19:11947405-11947427 CTTGATGAATAAATGAGGCATGG + Intronic
1163649839 19:18510824-18510846 CAGAATGACCAAATGAGGCCGGG + Intronic
1165558727 19:36659566-36659588 TTGTAAGATTAAATGAGGCTAGG - Intronic
1166097233 19:40548478-40548500 CAGGATGAACAAATCAGCCTGGG - Intronic
1166967874 19:46541259-46541281 ATGAATGAAAAAATGAGGCCGGG + Intronic
1167031662 19:46966051-46966073 CTGGATGTACAAGTGAAGCTAGG - Intronic
1168022186 19:53617261-53617283 CTTTAAGAAGAAATCAGGCTGGG + Intergenic
926008399 2:9390149-9390171 CTGGAAGAAGAAATGATGCTAGG - Intronic
928058694 2:28087197-28087219 GTGTAAGAACATATAAGGCTTGG + Intronic
928561836 2:32496517-32496539 CTGTATGAACAAATGAGGCTGGG - Intronic
931322947 2:61189568-61189590 CTTTAAGAACTAATGAGGCTGGG - Exonic
932107767 2:68962474-68962496 ATGTATAAAAAAATCAGGCTGGG - Intergenic
935511947 2:103986734-103986756 ATGAATGAACAAATGAAACTAGG - Intergenic
937546281 2:123025039-123025061 CTGTAGGAACAAGTTTGGCTTGG - Intergenic
939129211 2:138214105-138214127 ATGAATGAGCAAATGAGGCATGG + Intergenic
940430231 2:153581249-153581271 TTGACTGAACAAATGAGTCTGGG - Intergenic
941592530 2:167437642-167437664 CTGTTTGAACAGATGAGCCAGGG - Intergenic
941948224 2:171123496-171123518 CAGTATTAACAGATGAGGCCAGG - Intronic
942401643 2:175609453-175609475 CAGTAGGAACAAAGGAAGCTGGG - Intergenic
945791921 2:214316004-214316026 CTTCATGAACAAAAGAAGCTAGG - Intronic
946293328 2:218762924-218762946 CTGTCTGAAGGACTGAGGCTAGG - Intergenic
946411961 2:219519989-219520011 CTGTCTGGAAAATTGAGGCTGGG + Intronic
947649858 2:231777290-231777312 CTGTATGCATAAATTAGGCATGG - Intronic
948184559 2:236010392-236010414 CTGGATGACCAAACGAGGCCTGG - Intronic
1169496923 20:6123709-6123731 TTAAATGAACAAAGGAGGCTTGG - Intergenic
1172463007 20:35134321-35134343 TTGCATGAAAAAATGAGTCTTGG - Intronic
1172475467 20:35234200-35234222 GTGAATGAACAGAAGAGGCTAGG - Intronic
1176242549 20:64081752-64081774 CTGGATGTGCAAAGGAGGCTGGG - Intronic
1178621468 21:34180772-34180794 CTTTGTGAACAAATGAGACAAGG + Intergenic
1178684808 21:34702537-34702559 CTGCATGTACAACTGACGCTAGG - Intronic
1180337605 22:11593110-11593132 CTGTACAAACCATTGAGGCTAGG - Intergenic
1181901718 22:26161493-26161515 CAGCATGAACAAATGTGGGTTGG + Intergenic
1183099231 22:35573737-35573759 CTGTGTGAACAGAGGGGGCTGGG + Intergenic
1183329928 22:37213881-37213903 GTGAATGAATACATGAGGCTGGG - Intergenic
1183643679 22:39109415-39109437 CTGTAACAATAACTGAGGCTGGG + Intergenic
949267525 3:2175775-2175797 CTGTATGATCAGATCAGGTTAGG - Intronic
950352811 3:12373957-12373979 CTGTATGACTAAAAGAGGCAGGG + Intronic
951630969 3:24719869-24719891 CTGTATGAACAAATTACTGTAGG + Intergenic
956466544 3:69525674-69525696 CTGGGTGAAAGAATGAGGCTCGG - Intronic
960332049 3:116372325-116372347 CAGTATTAACAAATGGTGCTGGG + Intronic
961102596 3:124214184-124214206 CTGTATGCACAATTGAGACATGG + Intronic
967505540 3:190249122-190249144 CTGTTTCAACAAATGATGCTGGG - Intergenic
968108759 3:196024671-196024693 ATGCATGAACAAATGGGCCTTGG + Intergenic
969502137 4:7559587-7559609 CTGGAGCAACAAATGTGGCTGGG + Intronic
976723015 4:88188209-88188231 ATGTTTCAACATATGAGGCTGGG - Intronic
977834034 4:101627941-101627963 CTTTTTGAACAAATGGTGCTGGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
980662781 4:135886019-135886041 ATTTATGAACAAATGAGACTTGG + Intergenic
982261488 4:153498164-153498186 CTTTATTCACAAATGATGCTTGG + Intronic
984247021 4:177286997-177287019 CTGTATAAATACAAGAGGCTTGG + Intergenic
985470524 5:40900-40922 ATGCATGAACAAATGGGCCTTGG + Intergenic
985748443 5:1660820-1660842 GTGTGTGTACATATGAGGCTGGG + Intergenic
987351649 5:17027251-17027273 TTTTAAAAACAAATGAGGCTAGG - Intergenic
989709145 5:44375513-44375535 CTGTAGTAACAAACGAGGCCAGG + Intronic
993182282 5:84569849-84569871 CTGGATAAACAAATGTGGCATGG - Intergenic
993686101 5:90939974-90939996 CTATGTGAAGATATGAGGCTAGG - Intronic
994971890 5:106749656-106749678 ATGTATGAATAAATGAGGGATGG + Intergenic
995713270 5:115055856-115055878 CTTTAGGAACAGATGAGTCTGGG + Intergenic
998079561 5:139263249-139263271 CTGAATGAAATAATGAGGCCAGG + Intronic
1000106345 5:158062803-158062825 CTATATGAAGAATTGAGGCAGGG + Intergenic
1001249504 5:170135969-170135991 CTGGATGAAGAAATGGGGCTTGG + Intergenic
1002968210 6:1989029-1989051 CTGTAAGAAAAAATGAGCATGGG - Intronic
1003123069 6:3333811-3333833 CTGTATCAGAAACTGAGGCTGGG + Intronic
1003501066 6:6703226-6703248 CACTGTGAGCAAATGAGGCTTGG - Intergenic
1007428366 6:41761583-41761605 CTGAATGAACAACTGAGGGAAGG - Intergenic
1010830484 6:80522328-80522350 CTGTCTGAAGAAATCAAGCTTGG + Intergenic
1011743207 6:90384133-90384155 CTGCATGAACTAATAAGTCTTGG + Intergenic
1011804844 6:91060387-91060409 CTGTTTGGACCAATGAGACTGGG - Intergenic
1014800036 6:125768488-125768510 GTATAAGACCAAATGAGGCTAGG - Intergenic
1014884785 6:126766635-126766657 TTGAATGAACAAATTAGTCTTGG + Intergenic
1014914587 6:127130736-127130758 CGGTATGGACAAATGCTGCTTGG + Intronic
1017528729 6:155266549-155266571 AAGAATGACCAAATGAGGCTGGG + Intronic
1022504199 7:30900414-30900436 CTGTCTCCACAAAGGAGGCTAGG + Intergenic
1024251113 7:47506369-47506391 CTCTATGACCAAAGGAGGCCTGG - Intronic
1024305442 7:47925280-47925302 CTGTAGGAACACTTGAGGCCAGG + Intronic
1026316228 7:69230031-69230053 CTGTATCTACCAAAGAGGCTAGG - Intergenic
1026466836 7:70661739-70661761 CAGTTAGAACAAATGAGTCTGGG + Intronic
1028390086 7:90306033-90306055 CTGGAGGATCAAATGAGCCTGGG - Intronic
1028568909 7:92264705-92264727 ATTTATTGACAAATGAGGCTGGG - Intronic
1028798977 7:94939181-94939203 CTAGATGAAGAAATGAGGCTGGG - Intronic
1031370226 7:120956583-120956605 CTCTATGAACAAAAGAGCCCAGG - Intronic
1032773124 7:135079758-135079780 ATGTATAAAAAGATGAGGCTGGG - Intronic
1034605723 7:152311798-152311820 CTGTAGAATCAAATAAGGCTTGG + Exonic
1035241993 7:157538218-157538240 CTGAAGGAACACCTGAGGCTGGG - Intergenic
1035932540 8:3798855-3798877 CTGTATGAACAAAGGAAAATAGG - Intronic
1036911580 8:12761754-12761776 TTGTATGAACAAATGAGAAAAGG + Intergenic
1037043043 8:14261200-14261222 CTGTATTAGCAAAAGAGGCAAGG - Intronic
1039824656 8:41162779-41162801 ATAAATGAACAAATGAGGCCGGG - Intergenic
1041516597 8:58706395-58706417 CTTTTTAAACAAATGATGCTGGG - Intergenic
1042921947 8:73928803-73928825 CTGTCTCAACAAAGGAGGGTGGG + Intergenic
1043096155 8:75976433-75976455 CTGTATGGCCAAATGAGTCCAGG + Intergenic
1044618716 8:94167978-94168000 CTGTATGAATACATAAGACTTGG + Intronic
1049705927 8:144042150-144042172 CTGTGTCAAAAAAAGAGGCTGGG - Intronic
1050358064 9:4801757-4801779 CCGTTTCAACAAATGATGCTTGG - Intronic
1051241909 9:15066046-15066068 TAGTCTGAACAAATGATGCTGGG + Intergenic
1051732095 9:20154877-20154899 TTGTATGAGCATATGATGCTTGG - Intergenic
1052042802 9:23758729-23758751 CTCTATGATCAAATAAGGCCGGG + Intronic
1053305902 9:36984749-36984771 CTGTTGGAAAAAATGAGGCTGGG - Intronic
1053567845 9:39271605-39271627 CTGTGGGAACAGATGAGGCCTGG + Intronic
1053833852 9:42112552-42112574 CTGTGGGAACAGATGAGGCTTGG + Intronic
1054129298 9:61347394-61347416 CTGTGGGAACAGATGAGGCCTGG - Intergenic
1054596700 9:67074858-67074880 CTGTGGGAACAGATGAGGCTTGG - Intergenic
1055544649 9:77357022-77357044 CTATATTAAGAAATCAGGCTGGG + Intronic
1060964992 9:127707328-127707350 ACGTATGAGGAAATGAGGCTGGG - Intronic
1061188040 9:129066377-129066399 TTTTATTAAGAAATGAGGCTGGG + Intronic
1185568162 X:1112540-1112562 GTGTATGCACCTATGAGGCTGGG + Intergenic
1187192244 X:17046109-17046131 CTTTATGACAAAAGGAGGCTAGG - Intronic
1188028900 X:25242111-25242133 CTCTAAGATCAAATGAGCCTTGG + Intergenic
1189247623 X:39575951-39575973 CTGTGTGTACAAATGAGGGCTGG - Intergenic
1190879843 X:54484276-54484298 CTGCAAGAACACATGAGGGTGGG - Intronic
1194420765 X:93670447-93670469 CTGTAAGAAAAAATGAGTCAAGG + Intergenic
1197595506 X:128459259-128459281 CTGCATGACCAATTGTGGCTAGG + Intergenic
1198717710 X:139578152-139578174 TTGTTTTAACAAATGATGCTTGG - Intergenic
1199667659 X:150113571-150113593 GTATATGAACTAATGAGGCAGGG + Intergenic
1200969501 Y:9135732-9135754 CTGTATGAATAAGTAAGGCCTGG - Intergenic
1202141497 Y:21728505-21728527 CTGTATGAATAAGTAAGGCCTGG + Intergenic
1202145368 Y:21775297-21775319 CTGTATGAATAAGTAAGGCCTGG - Intergenic