ID: 928563731

View in Genome Browser
Species Human (GRCh38)
Location 2:32520053-32520075
Sequence TTCTATCTGTATACATAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928563731 Original CRISPR TTCTATCTGTATACATAAGA AGG Intronic
901583765 1:10269037-10269059 CTCTATCTGCATCCCTAAGAAGG + Intronic
904562016 1:31405334-31405356 TTGTATATATATACATGAGATGG + Intergenic
905712017 1:40113237-40113259 GGCTATCTGTATGCAGAAGAAGG + Intergenic
908591083 1:65634571-65634593 TTCTATCTGAATGCATTGGAAGG + Intronic
908652505 1:66351271-66351293 TAGTATCTGTGTACATGAGATGG + Intronic
910091330 1:83467879-83467901 TGCTCTCTGTATACATTACAAGG - Intergenic
910641101 1:89463096-89463118 TACTATTTGTATCCATAGGATGG + Intergenic
911786249 1:101951889-101951911 TTCTATCTTTATAAAGAAGGTGG + Intronic
912009526 1:104941514-104941536 TTGTATATGTATATATATGAAGG + Intergenic
915641091 1:157227124-157227146 TTTTATATGTAGACATATGATGG + Intergenic
916605139 1:166334990-166335012 TTGTATCTGGACAAATAAGAAGG + Intergenic
917867132 1:179207206-179207228 TTCTATCTATCTGAATAAGAAGG + Intronic
917897991 1:179511251-179511273 TTATATATGTATATATATGATGG - Intronic
918112266 1:181467287-181467309 TTGTAGCTTTATAAATAAGAAGG + Intronic
918289806 1:183095976-183095998 TTCTCTCTGTATGCATATAATGG + Intronic
919347502 1:196403701-196403723 TTCTCTCTGTAAACCTAAAATGG + Intronic
920612779 1:207457790-207457812 TTCTATCTCTAAATATTAGAGGG + Intronic
923780353 1:237017030-237017052 TTCTTTCTGTAAACTCAAGATGG + Intergenic
1063779199 10:9301867-9301889 TTCTATTTATTTATATAAGATGG - Intergenic
1063800842 10:9575619-9575641 TTCTTTCTCTATATATAAGTAGG + Intergenic
1065008905 10:21404191-21404213 TTCTTTCTGTAGCCCTAAGATGG + Intergenic
1066469590 10:35685494-35685516 TTCTATCTGTAAACTTCACATGG - Intergenic
1068477018 10:57540022-57540044 TTATATCTGTATATATATGTGGG + Intergenic
1070737638 10:78875219-78875241 TCCTAACTGTAAACGTAAGATGG - Intergenic
1072413233 10:95224836-95224858 TTCTTTTCTTATACATAAGATGG + Intronic
1073385301 10:103122296-103122318 TTCTATCTGTATTCTAAAGATGG + Intronic
1074715485 10:116214629-116214651 TTTTGTCTGTATTCATTAGAGGG - Intronic
1075734547 10:124655859-124655881 GTCTATCTGTCTACACTAGATGG + Intronic
1078996249 11:16702937-16702959 TTATATATATATACATATGAAGG - Intronic
1079315606 11:19405537-19405559 TTCTAACAGTATACAGAAGGAGG - Intronic
1080699812 11:34635269-34635291 TTCGCTCTGTATATTTAAGAAGG + Intronic
1081040452 11:38203555-38203577 GTCTATCTTTATAGGTAAGATGG - Intergenic
1081367413 11:42252885-42252907 ATGTATCTGTGTATATAAGAAGG - Intergenic
1085631895 11:78125396-78125418 TTTTATATGTATATATAAAATGG - Intronic
1086581150 11:88400377-88400399 TTCCATGTGTGTGCATAAGAGGG - Intergenic
1092387725 12:8048915-8048937 TTCTTTCTTTTTACACAAGATGG + Intronic
1094246413 12:28300453-28300475 TACAATCTCTATAAATAAGATGG - Intronic
1094794362 12:33953582-33953604 TTCTATTTATATACAGAAGATGG - Intergenic
1095106216 12:38236197-38236219 TTCTATTTATATACAGAAGATGG - Intergenic
1095256942 12:40049573-40049595 TTCTGACTGTGTACATAAAAAGG - Intronic
1095596490 12:43964973-43964995 TTAAATTTGTAGACATAAGAAGG - Intronic
1096483054 12:51955739-51955761 TCCTCTCTGTATTCATAAAAAGG + Intronic
1097000870 12:55875354-55875376 TTCTTTCTGTAACCTTAAGATGG - Intergenic
1098024951 12:66191451-66191473 TTCTATTTTTATATATAAGCTGG + Intronic
1098051944 12:66463457-66463479 TTCTATCTATAAACATGAGTGGG + Intronic
1098766834 12:74501269-74501291 TTTTATATGTAAACATAAGTTGG - Intergenic
1101859805 12:108473892-108473914 TTCTCTCTGTATTCAGGAGATGG - Intergenic
1103113824 12:118308008-118308030 TTATATCTGTAAATGTAAGAAGG + Intronic
1106753880 13:32801902-32801924 CTGTATCTGTATATATAAAAAGG + Intergenic
1107282522 13:38753255-38753277 TTATATGTGTATACATAATTTGG - Intronic
1109007363 13:56895047-56895069 TTGTATTTGTATGCATAAGTGGG - Intergenic
1109274024 13:60284542-60284564 TTATATCTTTATACATAAAGAGG + Intergenic
1109689609 13:65868435-65868457 TTCTATCTATATAAATAAATGGG - Intergenic
1110874886 13:80496613-80496635 TGCTATCTGGAAACATAAAATGG + Intergenic
1111315462 13:86552419-86552441 TTATATCTATGTACATTAGAAGG - Intergenic
1111404977 13:87792151-87792173 TTCGTTATGTATACAGAAGAGGG - Intergenic
1114637778 14:24197894-24197916 TTCTATTTGAATACAGAATAGGG - Intronic
1116470333 14:45279465-45279487 TTCTTTCTATATATAAAAGATGG - Intergenic
1116698794 14:48210786-48210808 TTGTATCTGGATACAGAAGGTGG + Intergenic
1116909354 14:50442813-50442835 TTCTTTCTTTATAAATAAGATGG - Exonic
1118416727 14:65546127-65546149 ATCTAACTGTATACTTAATATGG - Intronic
1120710281 14:87786432-87786454 TAGTATTTGTATATATAAGAGGG + Intergenic
1121858899 14:97298243-97298265 TTCTCTCTGTGAACATCAGATGG - Intergenic
1122243753 14:100386321-100386343 TCCTATCTGTTTACATAATTGGG + Intronic
1123451426 15:20364527-20364549 TTCTATATTTATACAAAAGTGGG - Intergenic
1125415280 15:39446032-39446054 TTGTATCTTTATACATAAAGAGG - Intergenic
1126423976 15:48505786-48505808 TTTTATGTGTATACTTAAGGAGG + Intronic
1127671537 15:61199629-61199651 TTCTATCTGTGTGACTAAGATGG - Intronic
1129764917 15:78158351-78158373 TGCTAGCTGTATACACATGAAGG + Intronic
1133591503 16:7248864-7248886 TCCTACCTATATACATAACAAGG + Intronic
1135204555 16:20472141-20472163 TTCAAACTGTACACATAGGATGG - Intronic
1135214333 16:20551670-20551692 TTCAAACTGTACACATAGGATGG + Intronic
1135596244 16:23745530-23745552 TTCTTTCTATATACCTAGGAGGG + Intergenic
1138901575 16:61276654-61276676 TTCTACCTGTATTCATGAAAAGG + Intergenic
1138935833 16:61721343-61721365 ATATATCTGCATACACAAGAGGG - Intronic
1139075319 16:63439907-63439929 CTGTAACTGTATACCTAAGATGG - Intergenic
1139928690 16:70507282-70507304 CTGTATCGGTATACACAAGAGGG + Intronic
1140528002 16:75640028-75640050 TTCTTTCTGTATAGATATAATGG + Intronic
1141087504 16:81107294-81107316 TTCAATCTGTATGCCTAAGCCGG - Intergenic
1145094331 17:20011108-20011130 TTTTATCTGTGTTCATAACAAGG + Intronic
1145890335 17:28410177-28410199 TTATATCTGTTTATATCAGAAGG - Intergenic
1147274290 17:39302105-39302127 TTCTATCTGGAAAAATATGAAGG + Intronic
1147596208 17:41719343-41719365 GTCTCTCTGAATACATAAAATGG - Intronic
1148177868 17:45583566-45583588 TTCTGTGTGTAAACAGAAGAGGG + Intergenic
1153046643 18:861530-861552 TTCTCTTTGTATACATTATATGG - Intergenic
1155084053 18:22439151-22439173 TTGTATCTGTAGTCATAAGCAGG - Intergenic
1156257745 18:35413892-35413914 TTCTATCTTTATATTTAAAATGG - Intergenic
1156664200 18:39385601-39385623 TTATATTTGTATACAAAGGAAGG - Intergenic
1157396283 18:47344393-47344415 TTCTATCTGTGAACACAGGATGG + Intergenic
1158581661 18:58689593-58689615 TTCTATTTTAATACCTAAGACGG + Intronic
1158807324 18:60989842-60989864 GTCTGTCTGTCTATATAAGAGGG - Intergenic
1159416749 18:68160242-68160264 ATCTATCTTTAAACATAAAAAGG - Intergenic
1165299985 19:34962690-34962712 TTCTATTTGTATACATGATCTGG + Intronic
925064139 2:916026-916048 TTGTTTCTCTACACATAAGAAGG - Intergenic
927373314 2:22383074-22383096 TTCAATCTGTTTACCAAAGACGG - Intergenic
928563731 2:32520053-32520075 TTCTATCTGTATACATAAGAAGG + Intronic
928647664 2:33371748-33371770 CTGTAACTGTATACCTAAGATGG - Intronic
930437798 2:51368088-51368110 TTCTATATGTCTCCATAAGTAGG - Intergenic
930931109 2:56885274-56885296 TTCTATTTTTATATATAATATGG - Intergenic
933449350 2:82427208-82427230 TTGTACCTATAGACATAAGAAGG - Intergenic
936488718 2:112950720-112950742 TTATGGCTGTATACATATGATGG + Intergenic
936639572 2:114297102-114297124 TTCTATCTGTATGCATACAATGG + Intergenic
937401802 2:121590541-121590563 TTATATCTGTAGAAAAAAGATGG - Intronic
937964871 2:127497195-127497217 TTATATGTGTATATATAACAGGG - Intronic
939854373 2:147340094-147340116 TTCTATCTGCAGACATAACTCGG - Intergenic
940775782 2:157882525-157882547 TTCTTTGTGTATACATTTGATGG - Intronic
946063313 2:216964685-216964707 TTCTATATGTATACATAGATTGG - Intergenic
1169933923 20:10862925-10862947 TTCTGTCTGAATGCACAAGATGG + Intergenic
1170931212 20:20770868-20770890 TTCTATATGTATTCATCCGAGGG - Intergenic
1171122523 20:22579126-22579148 TTCTGTCCGAATACATAAAAAGG - Intergenic
1176519906 21:7816481-7816503 TTCTATCTGCAGACATCAGAGGG + Intergenic
1177955824 21:27597829-27597851 TTTTATCTGTTTACATTAGTAGG - Intergenic
1178653934 21:34446494-34446516 TTCTATCTGCAGACATCAGAGGG + Intergenic
1185188781 22:49419536-49419558 TTATGTCTTTATACATCAGAAGG - Intronic
949116348 3:330035-330057 TTCTATGTGTTTTCATTAGATGG - Intronic
951162309 3:19439805-19439827 TTTTATCTTTGTGCATAAGATGG - Intronic
951228914 3:20153840-20153862 TTCTATCAGCATAAATAAAATGG + Exonic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
953159052 3:40401221-40401243 TTTTATCTGTATACATGGAAAGG + Intronic
953352432 3:42225560-42225582 CTCTCTCTGAATACATAAAATGG - Exonic
956352438 3:68352566-68352588 ATCTGTCTGTATAGAAAAGAAGG + Intronic
957714384 3:83906173-83906195 TGCTATCTGTATCCATCAGAGGG + Intergenic
957794226 3:84982278-84982300 TTCTAGATGTAGACATAAAATGG + Intronic
958025457 3:88043518-88043540 TTCTATTTGTTTATATAGGATGG - Intergenic
960661100 3:120059878-120059900 TTCTAAGTGTTTACAGAAGAAGG - Intronic
960787942 3:121395033-121395055 TTTCATCTGTCTATATAAGAAGG - Intronic
961135655 3:124508070-124508092 TTTTATCTATAGAAATAAGATGG - Intronic
961775646 3:129282720-129282742 TGCTATCTATATACATATGCAGG - Intronic
964161510 3:153651393-153651415 TGGTGTATGTATACATAAGACGG + Intergenic
964873780 3:161342590-161342612 TTCTTTCTGTAAACTCAAGATGG - Intergenic
964898830 3:161632250-161632272 TTTTATTTGTAGAGATAAGAGGG + Intergenic
965128110 3:164656560-164656582 TTGTTTCTGTATATATTAGATGG - Intergenic
965842977 3:172928540-172928562 TGCTATCTATCTACATAAGGGGG - Intronic
966580247 3:181553466-181553488 TTTTATCTGTTTACTTACGATGG - Intergenic
967008060 3:185403732-185403754 GTTTATCTGTATATATAAGTTGG - Intronic
967248147 3:187509478-187509500 TTCTATCTGTAGCCTCAAGATGG - Intergenic
968011262 3:195279269-195279291 TTTTAGCTGTATACATTAGGGGG + Exonic
969215129 4:5715657-5715679 TTCTATCTTTATACTTAATTTGG + Intronic
971277261 4:25210139-25210161 TTCTTTCTGTAAACTCAAGATGG - Intronic
971773960 4:30936000-30936022 TTTTATGTGTATTTATAAGAGGG - Intronic
972084429 4:35196919-35196941 TTCTATCTGTAATGTTAAGAAGG + Intergenic
972786503 4:42331400-42331422 TTCTATTTGTATGAAGAAGATGG + Intergenic
973037540 4:45424714-45424736 AACTATGTGTATACATAAGGAGG - Intergenic
973042906 4:45495491-45495513 ATATATGTGTATACATAAAAAGG + Intergenic
973278683 4:48336599-48336621 ATATAACTGTTTACATAAGAAGG + Intergenic
973966232 4:56164757-56164779 TGTGAGCTGTATACATAAGAAGG + Intergenic
974621267 4:64358361-64358383 TTCTAACTGCCTCCATAAGAAGG - Intronic
975158253 4:71095800-71095822 TTCTGTAGGTATACATAGGAGGG + Intergenic
975850392 4:78565953-78565975 ATTTTTCTGTATACAGAAGAGGG + Intronic
976663722 4:87567629-87567651 TTCTATCTGTGTACTTTAGAAGG - Intergenic
978439644 4:108719910-108719932 ATCTATCTGTACACCTAAGAAGG + Intergenic
978673223 4:111276877-111276899 TTAAATCTATACACATAAGAGGG - Intergenic
979393954 4:120163197-120163219 ATATATTTGTAAACATAAGACGG - Intergenic
979769855 4:124509486-124509508 TTGCATCTATATTCATAAGAAGG - Intergenic
979887342 4:126045606-126045628 TTCTCCCTGTATACAGAGGAAGG + Intergenic
979953430 4:126924221-126924243 TTCCATATGTTTACATAATAAGG - Intergenic
980082049 4:128354449-128354471 TTCTTTCTGTAAACAAAAGCAGG + Intergenic
981566043 4:146102832-146102854 TTCTATGTGTATACATATATTGG + Intergenic
982183451 4:152772337-152772359 TTCTATCTGTAAAAAAAAAAAGG + Intronic
982665459 4:158255914-158255936 TTCTGTCTCTGTACACAAGATGG - Intergenic
982754727 4:159204549-159204571 TTCTATCTGTTTACATTGGAAGG + Intronic
983050660 4:163043202-163043224 TTCTATTTGTATATATCAAAAGG - Intergenic
987779266 5:22412055-22412077 TTCTGTCTGTCTACCTATGATGG - Intronic
987966579 5:24884889-24884911 TTCTATCTGAATACAGTAGAGGG + Intergenic
987996257 5:25284414-25284436 TTCTATTTCTATACATCACAGGG - Intergenic
988252433 5:28777221-28777243 TTATATTTGAATACATAAGTTGG + Intergenic
988574322 5:32405344-32405366 TTCTAGATGCGTACATAAGAAGG - Intronic
991503494 5:67301048-67301070 TTCTACCTGTGTTCATCAGAGGG - Intergenic
992068436 5:73128226-73128248 TTCTATCTCTATACATTTAATGG + Intronic
994623129 5:102186973-102186995 TTCTATCTTGATATATAGGAAGG - Intergenic
995536056 5:113137731-113137753 TTTTAGGTGTATTCATAAGAAGG + Intronic
996510578 5:124311470-124311492 TTTTATTGGTATAAATAAGAGGG + Intergenic
996531035 5:124527204-124527226 TTCCATTTTTACACATAAGAAGG + Intergenic
998337510 5:141386172-141386194 TAGGATCTGTGTACATAAGATGG - Intronic
998441966 5:142170156-142170178 TTCTACCTGTATACATATGCAGG - Intergenic
1003033342 6:2621647-2621669 TTCTATCTTAAAACATATGAAGG - Intergenic
1005802203 6:29438460-29438482 TTATATCAATATACATAAGAAGG + Intronic
1007106831 6:39289172-39289194 TTCTCTCTGTAAACTCAAGATGG - Intergenic
1008366426 6:50686166-50686188 TTCTATTTGTAGACATTGGAAGG + Intergenic
1009350600 6:62672249-62672271 TACTATCTGGATAAATAAGTAGG + Intergenic
1009788885 6:68373914-68373936 TCCTATCTGTATTCCTGAGAAGG - Intergenic
1010168100 6:72941219-72941241 TTCTATCTGCATGCATAGGATGG + Intronic
1010338234 6:74714889-74714911 TTCTATTTGTATCCAAACGATGG + Intergenic
1011851681 6:91636968-91636990 GTCTATCTGTGCACACAAGAGGG + Intergenic
1011934550 6:92759070-92759092 TTCTATCCTTGTGCATAAGATGG - Intergenic
1013050279 6:106527204-106527226 TTCTATATATATATATAAAATGG + Intronic
1016689716 6:146923216-146923238 TTCTAGCTGTATACAACAGGAGG - Intergenic
1020412916 7:7913032-7913054 TTCTATCAGAACACATAAAAAGG + Intronic
1020769026 7:12364243-12364265 TTCTAACTGTATCCATTAAAAGG + Intronic
1022569645 7:31439167-31439189 TTCTATCTGTCTTCTTTAGAAGG + Intergenic
1022671268 7:32458403-32458425 TTTTATCTGTTTGCCTAAGAAGG - Intergenic
1023641413 7:42262827-42262849 ATTTATCTTTATACCTAAGAGGG + Intergenic
1024093570 7:45967288-45967310 TTATATTTTTATATATAAGATGG + Intergenic
1024147636 7:46533505-46533527 TTCTTTCTGTAACCTTAAGATGG + Intergenic
1026852018 7:73730409-73730431 TTTTATCTGTCTACATAAACTGG - Intergenic
1027308173 7:76924328-76924350 TGCTCTCTGTATACATTACAAGG - Intergenic
1028015921 7:85712008-85712030 TTATATCTGTATAACTAAGAGGG + Intergenic
1029019378 7:97348142-97348164 TACCATCTATCTACATAAGAAGG - Intergenic
1030288029 7:107846777-107846799 ATGTATCTGTATACATATAATGG - Intergenic
1030368331 7:108671331-108671353 TTCTATTTGTATAATTAAGTAGG - Intergenic
1030942176 7:115666515-115666537 TTCTATGTGTGTATATAATATGG - Intergenic
1031366834 7:120911553-120911575 TTATATTTGTATACTTAAGGAGG - Intergenic
1031723698 7:125209299-125209321 TTCTATCTGTATAAATTTAAGGG - Intergenic
1032182927 7:129696818-129696840 TTGTATCTTTATAAATGAGAAGG + Intronic
1032301978 7:130696045-130696067 TTCTATCTGTCACCATCAGAGGG - Intergenic
1032327937 7:130949790-130949812 TGCTATTAGTACACATAAGAGGG + Intergenic
1032497186 7:132371221-132371243 TGCCTTCTGTATACATAACACGG - Intronic
1032832285 7:135640376-135640398 TTCAAACTGTATACCTAAAATGG - Intronic
1032977666 7:137243565-137243587 TTCTACCTCTAAACACAAGAAGG - Intronic
1033471137 7:141650244-141650266 TTCTTGCTGTATCTATAAGAAGG + Intronic
1035932434 8:3796666-3796688 ATCTATATGTATACATTGGAAGG + Intronic
1036742657 8:11378856-11378878 ATTGATCTGTACACATAAGATGG - Intergenic
1036953898 8:13166648-13166670 TTCAATCAGTTTAAATAAGATGG - Intronic
1037702958 8:21291629-21291651 TTCTATGGGTATCCAGAAGAAGG + Intergenic
1040928141 8:52706966-52706988 ATCTTTATGTAAACATAAGAGGG + Intronic
1041470317 8:58200873-58200895 TGCTATCAGGATAAATAAGATGG - Intronic
1042076083 8:64996542-64996564 TTCTGTCTGTATTAATAGGAGGG + Intergenic
1042827844 8:72996251-72996273 TTCTGTATGAATACATATGAAGG - Intergenic
1042997216 8:74714378-74714400 TTTTATCTGTTTACAAAAGACGG + Intronic
1045457012 8:102390542-102390564 TTCTATCAGTATACATTACCGGG - Intronic
1045678102 8:104630500-104630522 ATCTTTCTGTGTACACAAGATGG + Intronic
1046794452 8:118355664-118355686 TTCTTTCTGTGTACATAAAGAGG - Intronic
1047104202 8:121715489-121715511 TTCTTTATTTATACATAAGAGGG + Intergenic
1047621196 8:126609852-126609874 TTTTATCTGTAAAAATGAGAAGG - Intergenic
1047811608 8:128416189-128416211 TTTTATCTTTGTGCATAAGATGG + Intergenic
1048659943 8:136587886-136587908 TTATATATTTATAAATAAGAAGG - Intergenic
1048909057 8:139116783-139116805 TTCCATCTGTAGACATCAGTGGG - Intergenic
1048926124 8:139273236-139273258 TTCAAACTGTATACTTAAAATGG - Intergenic
1049870853 8:144974724-144974746 TTAAACCTGTTTACATAAGATGG - Intergenic
1051864620 9:21665629-21665651 TTCTTTCTTTATACCTAGGATGG - Intergenic
1052428869 9:28340204-28340226 GTTTCTTTGTATACATAAGATGG + Intronic
1053162158 9:35820615-35820637 TGCTCTCTGTGTACCTAAGAAGG + Intronic
1055020003 9:71659452-71659474 TTCTATTTTTATACTAAAGATGG + Intergenic
1055862791 9:80773555-80773577 TTCTATCTACATACTTAAGAAGG - Intergenic
1056619055 9:88195223-88195245 TTCTTTCTGTAACCACAAGATGG - Intergenic
1057976909 9:99614969-99614991 TTCAATCTGTATATATACAATGG + Intergenic
1058735943 9:107894272-107894294 TTCTATCTGTATAATTGTGAAGG + Intergenic
1058854479 9:109047418-109047440 TTATATTTGTGGACATAAGAGGG - Intronic
1058941651 9:109818521-109818543 CTGTATCTGTATTGATAAGAAGG + Intronic
1060341960 9:122785475-122785497 CTCCTTCTGTATACATGAGAGGG + Intergenic
1060577334 9:124708698-124708720 TTCCATGTGTATATATAAGCTGG + Intronic
1061351321 9:130067130-130067152 CTCTCTCTGCATACATAAGAGGG - Intronic
1061459087 9:130721736-130721758 AAGTATCTGTATACATTAGAAGG + Intronic
1186013435 X:5164002-5164024 TTCTTTCTGTAAACTCAAGATGG + Intergenic
1186074207 X:5859409-5859431 TTCTATGTGTGTACTTACGAGGG + Intronic
1187073279 X:15909953-15909975 TTCTTTCTGTAACCTTAAGACGG + Intergenic
1188209101 X:27398195-27398217 TTCTATATGTGTAAATAAAAAGG - Intergenic
1188374215 X:29407575-29407597 ATATATGTGTGTACATAAGACGG - Intronic
1191905645 X:66085932-66085954 TTCTGTCTGTATCCTTAAGGTGG - Intergenic
1193388538 X:80899371-80899393 TTATATATGTATACATAAATAGG - Intergenic
1194875131 X:99177863-99177885 TTCTTTGTTTATCCATAAGAAGG + Intergenic
1194992656 X:100561729-100561751 TTCTATCTGTAAAAATAAGAGGG + Intergenic
1196263581 X:113614708-113614730 TTTTTTCTGTATAAGTAAGATGG + Intergenic
1196283685 X:113854531-113854553 TTCTATCAGTAGATATAAGTTGG + Intergenic
1198363484 X:135918112-135918134 ATCTATCTGTCTACATAAAAGGG + Intergenic
1198721406 X:139624921-139624943 TATTATCTGTATATATATGAGGG + Intronic
1199788746 X:151130052-151130074 TTCTATGTTTATCCAAAAGACGG + Intergenic
1199820566 X:151441688-151441710 TTTTTTCTGTATTCTTAAGATGG + Intergenic