ID: 928564256

View in Genome Browser
Species Human (GRCh38)
Location 2:32527489-32527511
Sequence GGGTGCAGAAAATTTTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928564251_928564256 20 Left 928564251 2:32527446-32527468 CCACTTTCTTGAACAGCATGCTG 0: 1
1: 1
2: 2
3: 12
4: 151
Right 928564256 2:32527489-32527511 GGGTGCAGAAAATTTTCAAAAGG 0: 1
1: 0
2: 3
3: 27
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928564256 Original CRISPR GGGTGCAGAAAATTTTCAAA AGG Intronic
901780903 1:11593950-11593972 GTCTGCACAACATTTTCAAAGGG + Intergenic
902891213 1:19445041-19445063 GGGTCAAAAAAATTTTAAAAAGG - Intronic
905036845 1:34924245-34924267 GGGAGTAAAAAATATTCAAATGG - Intronic
905402238 1:37712158-37712180 GGGTACTGAAAATTTGCAGATGG - Intergenic
906869534 1:49462528-49462550 GGGAGAAGAGAATTCTCAAAGGG + Intronic
908765549 1:67551758-67551780 GGCTGCAGAAGTTTTTCCAATGG - Intergenic
909095753 1:71286216-71286238 GGGTGTAAAAATTTTTGAAAAGG - Intergenic
909189059 1:72529008-72529030 GCAAGCAGAAAATTTTTAAAAGG - Intergenic
910149124 1:84120248-84120270 AGAAGTAGAAAATTTTCAAATGG + Intronic
912141093 1:106728499-106728521 GACTGCGGGAAATTTTCAAAAGG + Intergenic
912726321 1:112061762-112061784 GGGTTTACAGAATTTTCAAAAGG - Intergenic
913137380 1:115905813-115905835 GGGAGCAGCCAGTTTTCAAAGGG + Intergenic
915659814 1:157393984-157394006 GGGTAGAAAATATTTTCAAAGGG - Intergenic
915776937 1:158500673-158500695 AGGTGCTGCAAATTTTGAAATGG + Intergenic
917287634 1:173437869-173437891 GGGTGCAGAAAATTTTATGATGG - Intergenic
917813136 1:178679816-178679838 GGGTGTGGAAGGTTTTCAAAAGG + Intergenic
917864868 1:179184720-179184742 GACTGGAGAAAATTTTAAAAAGG - Intronic
918310898 1:183284460-183284482 GGGTGCAGAACTTTTTCACATGG + Intronic
918772105 1:188574258-188574280 AGATGCATAAAATGTTCAAATGG - Intergenic
919474007 1:198011975-198011997 GGTAGCAGGAAATTTCCAAAAGG + Intergenic
919995141 1:202740944-202740966 CAGTGCAGATAATTTTCAACAGG - Intronic
920453268 1:206076750-206076772 GGGTGTGGAAGGTTTTCAAAAGG + Intronic
921444018 1:215223099-215223121 TGGTGAAGAAAATTTCCAAATGG + Intronic
921463460 1:215456947-215456969 GGGGGTAGAAGGTTTTCAAAAGG - Intergenic
921563111 1:216682194-216682216 GGGTGCATAAAATTCTCATAAGG + Intronic
922200348 1:223395187-223395209 GGGTGCAGCACATTTCCCAAGGG + Exonic
924275931 1:242386894-242386916 GTCTGCAAAATATTTTCAAATGG + Intronic
1063033205 10:2256735-2256757 GGGTGCAGAATCTTGTCACAGGG + Intergenic
1063397638 10:5705919-5705941 GGGTACATAAAGTTTTCATAGGG - Intronic
1063402203 10:5757040-5757062 TGGTTCAGAAAATTTCCAAAAGG - Intronic
1064283247 10:13970006-13970028 GGTTTCAGAAAAGCTTCAAATGG + Intronic
1064321889 10:14312933-14312955 ATGTGCAGATAATTTCCAAAAGG + Intronic
1064849107 10:19689953-19689975 GATTTCAGTAAATTTTCAAATGG - Intronic
1065817699 10:29497032-29497054 TGATGCAGAAAATTGGCAAATGG + Intronic
1066080440 10:31926640-31926662 GGGTGATTAAAATTTTTAAATGG - Intronic
1066263928 10:33756656-33756678 CTGTGCATAAAATTCTCAAATGG + Intergenic
1069015315 10:63422747-63422769 GGGCACAGAAAATATTCAAATGG + Intronic
1069462274 10:68606707-68606729 GGGTGTTGAAAATATTCACAAGG + Intronic
1070209755 10:74304266-74304288 TTTTGCAGAAAATTTTCAATTGG - Intronic
1071108621 10:82127988-82128010 AGGTACTGAAAATTTACAAATGG + Intronic
1071169459 10:82847220-82847242 TGGAGCAGATAATTTCCAAATGG - Intronic
1074434156 10:113419485-113419507 GCTTTCAGTAAATTTTCAAACGG - Intergenic
1079289196 11:19171787-19171809 AGTTTCAGATAATTTTCAAAAGG + Intronic
1079307020 11:19332421-19332443 CTCTGCAGAAAATTTTGAAAAGG - Intergenic
1080622536 11:33998509-33998531 GGCTGCAGAACTTTTTAAAATGG + Intergenic
1080748598 11:35131554-35131576 GGGTGCAGGCAATTTTAATAAGG - Intergenic
1081416952 11:42827288-42827310 GTGTGCAGTAAATTATCAATAGG - Intergenic
1085992821 11:81870994-81871016 TGTTGCTGAAAATTTTCAAGTGG + Intergenic
1086692072 11:89799443-89799465 TAGTGTAGAAAATTTTAAAAAGG - Intronic
1086713727 11:90040213-90040235 TAGTGTAGAAAATTTTAAAAAGG + Intronic
1087946035 11:104161784-104161806 TAGTTTAGAAAATTTTCAAATGG - Intronic
1088761391 11:112932224-112932246 GTTTGCAAAATATTTTCAAAAGG - Intergenic
1090679319 11:129036662-129036684 GAGTGCAGGAATTTTTCCAAAGG - Intronic
1090771960 11:129928720-129928742 GTGGGCAGAAAATTGTCCAAAGG - Intronic
1092552596 12:9520435-9520457 GGATGCAGACAATATACAAATGG + Intergenic
1093091902 12:14931290-14931312 GGATCCAGAAAATTTTCAATAGG + Intronic
1093537032 12:20234478-20234500 AGGTGTGGAAAGTTTTCAAAAGG + Intergenic
1093629611 12:21392771-21392793 GAATGCATAAAATTTTCCAATGG + Intronic
1094519519 12:31170182-31170204 GGATGCAGACAATATACAAATGG - Intergenic
1094848400 12:34371542-34371564 GGTGGCAGAAAATCTTGAAAGGG - Intergenic
1094855636 12:34401631-34401653 GGGGGCAGGAAGTCTTCAAAGGG + Intergenic
1095673599 12:44890645-44890667 GGGGGGAGAAAATTTTGAACTGG - Intronic
1098932118 12:76430377-76430399 GGGTCCAGAAAAATGGCAAAAGG + Intronic
1099069596 12:78028965-78028987 ATGTGTGGAAAATTTTCAAAAGG + Intronic
1099118811 12:78662264-78662286 GGGTGCTGATAATTTTAATAAGG + Intergenic
1099312242 12:81041549-81041571 GGGTGAGGAAGATTTTCATAAGG - Intronic
1100104038 12:91146705-91146727 GGGAAAAGCAAATTTTCAAAAGG - Intronic
1101730232 12:107420775-107420797 GGGTGCAGAAAAGCTTCTGAAGG - Intronic
1104379401 12:128293970-128293992 TGGTGCAGAATATTTCCGAAGGG + Intronic
1105059125 12:133131603-133131625 GTGTGGAGGTAATTTTCAAAAGG - Intronic
1106828359 13:33549942-33549964 GAGTGTGGAAAGTTTTCAAAAGG - Intergenic
1107149785 13:37098074-37098096 GCAAGCAGAAAATTTTTAAAGGG - Intergenic
1107214140 13:37895780-37895802 GGGTATAGAGAATTTTAAAAAGG + Intergenic
1107972690 13:45659203-45659225 GGGTGGAGAAATTTTTTGAAGGG + Intergenic
1108136784 13:47372662-47372684 GGGTGTGGAAAGTTTTCGAAAGG - Intergenic
1108205813 13:48088840-48088862 GTGGCTAGAAAATTTTCAAATGG + Intronic
1108358052 13:49644701-49644723 GGCTGCAGCTCATTTTCAAATGG - Intergenic
1108695964 13:52902647-52902669 GGGAGAAAAAAATTTTCAATGGG - Intergenic
1109050595 13:57476499-57476521 GGGTGTAGCAAATGTTCAAAAGG + Intergenic
1109182115 13:59226143-59226165 GGCTTCTGTAAATTTTCAAAAGG - Intergenic
1109221006 13:59641000-59641022 TGGTGCAGAAGATTTTCAGATGG + Intergenic
1111317914 13:86585318-86585340 AGGGGGAGAAAATTTTTAAAAGG + Intergenic
1111771739 13:92605515-92605537 TGATGCAGAAATGTTTCAAAGGG - Intronic
1111945148 13:94657291-94657313 GGGTGTGGAAGGTTTTCAAAAGG + Intergenic
1112298315 13:98208611-98208633 GAGTGAATAAAATCTTCAAAAGG + Intronic
1113038733 13:106081101-106081123 AGGTGGAGAATATTTTCACATGG - Intergenic
1113375667 13:109763263-109763285 GCTTGCAGATAATTTTCAAAGGG - Intronic
1114846238 14:26326018-26326040 TAGTGCAGAAAATGTTCAGAAGG + Intergenic
1116690178 14:48095995-48096017 GGGTGTGGAAGGTTTTCAAAAGG - Intergenic
1118628382 14:67679735-67679757 CGATGCAGAAAATTTTCTTAAGG + Intronic
1118972165 14:70646081-70646103 GTGTGCAGGCAATTTGCAAAGGG + Intronic
1120057529 14:79942414-79942436 TGGTCCACAAAATTTTTAAAGGG - Intergenic
1120673906 14:87396473-87396495 GTGGGCACAAAATTTTCAGAAGG + Intergenic
1125244535 15:37619783-37619805 GGGTGTGGAAGGTTTTCAAAAGG + Intergenic
1125977401 15:43966893-43966915 GGTTGCAGAAAGTTTACAGAGGG + Intronic
1127486641 15:59424161-59424183 GGCTGCTGAAAAGTTCCAAAAGG - Intronic
1128048037 15:64636542-64636564 TGATCTAGAAAATTTTCAAAAGG - Intronic
1130753343 15:86736807-86736829 GGGAGCTAAAAATGTTCAAAGGG - Intronic
1131309337 15:91273786-91273808 GGGAGAAGAATATTATCAAAAGG - Intronic
1131625591 15:94116479-94116501 GGGAACAGAAAATTATTAAAAGG + Intergenic
1132407273 15:101551470-101551492 GGGTGCAGAGGATTTTTGAAAGG + Intergenic
1133100618 16:3477168-3477190 GGGTGAAAAAAATTTTACAAGGG + Intronic
1134415202 16:14037457-14037479 GGGGGCTGGAGATTTTCAAATGG + Intergenic
1135819100 16:25664825-25664847 GGGTGCATAAAATCTTTCAAAGG - Intergenic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1136735123 16:32460208-32460230 GTGTATAGAAAATTTTAAAATGG - Intergenic
1136948528 16:34686883-34686905 TGGTGCAAAAAATTTTCATAAGG + Intergenic
1136955928 16:34786764-34786786 TGGTGCAAAAAATTTTCATAAGG + Intergenic
1137289708 16:47043640-47043662 GGGAGCAGAATATTTTATAATGG - Intergenic
1141911690 16:87064271-87064293 ACGTGCAGAAGATTTTAAAAAGG + Intergenic
1203017956 16_KI270728v1_random:369385-369407 GTGTATAGAAAATTTTAAAATGG + Intergenic
1203036291 16_KI270728v1_random:642543-642565 GTGTATAGAAAATTTTAAAATGG + Intergenic
1145219329 17:21075445-21075467 TGGTGCAGAAAAATTTCAAATGG - Intergenic
1149130822 17:53299701-53299723 GGATGCTGAACATTGTCAAATGG - Intergenic
1150000273 17:61431856-61431878 GAGTGCAGAAGGTTTTCAAAAGG - Intergenic
1150440074 17:65183844-65183866 GGGTGCAGACAATTGGCACAGGG - Intronic
1150505243 17:65692101-65692123 GGGTGCACAAAATTGTCGTAAGG - Intronic
1150886369 17:69090990-69091012 GGATGATGAAAATGTTCAAAAGG - Intronic
1152444607 17:80334300-80334322 GTGTGGAGAAAGTTTTCAGATGG + Intronic
1153116053 18:1657882-1657904 GGCTGCAGAAGCTTTTCAATAGG - Intergenic
1155837332 18:30602495-30602517 GGGTGGAGGAAAATGTCAAAGGG - Intergenic
1156616205 18:38787539-38787561 GGGTGTGGAAGATTTTCAAAAGG + Intergenic
1157055318 18:44221501-44221523 GGGTGAAGGATATCTTCAAAGGG + Intergenic
1158719064 18:59907572-59907594 GGGTACAGTAATTTTTCAAAAGG + Intergenic
1165767256 19:38359296-38359318 GGGAGCTGAAGATTCTCAAAGGG + Intronic
927329352 2:21843545-21843567 AGCTGAAGAAAATTTTCAAGAGG - Intergenic
928564256 2:32527489-32527511 GGGTGCAGAAAATTTTCAAAAGG + Intronic
929886689 2:45884862-45884884 AGGTGCAGACAATTTCCAGAAGG - Intronic
930352865 2:50279862-50279884 GGGTACAAAATAATTTCAAATGG + Intronic
930359059 2:50355679-50355701 GAGTTCAGAAATTTTTCCAATGG - Intronic
931533621 2:63246558-63246580 GGGTGCAGAAGGTTTTCAAAAGG + Intronic
932205179 2:69874193-69874215 TGGTGCATACAATTTTCTAATGG + Intronic
932825015 2:74930991-74931013 AGGTGCAGGAAATGTTGAAAGGG + Intergenic
934310657 2:91859518-91859540 GTGTACAGAAAATTTTAAAATGG + Intergenic
937894728 2:126970142-126970164 GCGTGCAGGAATTTTTCACAGGG - Intergenic
939430470 2:142099340-142099362 GGAGGCAATAAATTTTCAAAAGG + Intronic
939732563 2:145802844-145802866 GGGGGCATACAATTTTAAAAAGG + Intergenic
939907391 2:147933689-147933711 TAGTTCAGAAAATTTTTAAAAGG + Exonic
940780515 2:157928639-157928661 GGGTGTGGAAGATTTTCAAGAGG - Intronic
941087374 2:161133668-161133690 GGGTGCAGAAGTTCTTAAAATGG - Intergenic
943435273 2:187858073-187858095 TAGTGGAGAAAATTCTCAAAAGG + Intergenic
944507663 2:200429471-200429493 TGGTGAAGAAACTTGTCAAAGGG + Intronic
945095595 2:206216084-206216106 GCCTTCAGAAAATTTGCAAATGG - Intronic
945115313 2:206402602-206402624 GGATGTAGAAAATTATCCAAAGG + Intergenic
945128989 2:206545624-206545646 TGATGCAGAAAAGTTTTAAAGGG + Intronic
946491742 2:220155546-220155568 GTGTGCTGAGACTTTTCAAAGGG + Intergenic
946828782 2:223706215-223706237 GGGTGCAGAAGATACTCAAAAGG + Intergenic
947899617 2:233710569-233710591 GTGTGCGGAAGATTTTGAAAGGG - Intronic
1168918754 20:1513510-1513532 GTGAGTAGAAAATTTTGAAAAGG + Intergenic
1168944560 20:1741765-1741787 GGCTGCAGAATCTTTTCACATGG - Intergenic
1170920773 20:20677587-20677609 GGCTGCTGTAAAGTTTCAAACGG - Intronic
1172645980 20:36469894-36469916 GGCTGCAGAAAATTCACACAAGG - Intronic
1174537547 20:51263718-51263740 GAGGAGAGAAAATTTTCAAATGG + Intergenic
1176913280 21:14594648-14594670 AGGTACATAAAGTTTTCAAAAGG - Intronic
1177804663 21:25862633-25862655 GCTTGCAGAAAATTGACAAATGG - Intergenic
1180537406 22:16405449-16405471 GTGTATAGAAAATTTTAAAATGG + Intergenic
949279088 3:2325042-2325064 GGGTAGTGAAAACTTTCAAATGG + Intronic
950828379 3:15849713-15849735 TGGGGCAGAAAATTTTCTAGGGG - Intronic
952124745 3:30287222-30287244 GGATGCAGAAAAATTTGGAAGGG - Intergenic
953653652 3:44829906-44829928 AGGAGAAGAAAATTTTTAAATGG - Intronic
955296635 3:57741328-57741350 TGGTGCTTAAATTTTTCAAAAGG + Intergenic
956642996 3:71432285-71432307 GGGTGCAGGAAAGTAGCAAAAGG - Intronic
957144699 3:76408979-76409001 GGGTGTAGAAAATTTTAGACTGG + Intronic
958082739 3:88767841-88767863 GGCTCCAGAAAATTTCCATATGG + Intergenic
959607362 3:108256791-108256813 GGGTACAGAAAATGTTCTTAAGG + Intergenic
961930418 3:130527439-130527461 GGGTGCTGAACATTTTTGAATGG - Intergenic
963639896 3:147846622-147846644 GGGTTTAGAAAATTTTCTATTGG + Intergenic
965534576 3:169811960-169811982 GGGCGCAGAAATATTTAAAACGG + Intronic
965710538 3:171552541-171552563 AGGTGCAGAAAATTGTGTAATGG + Intergenic
965933658 3:174079231-174079253 ATGAACAGAAAATTTTCAAAAGG + Intronic
966156988 3:176927287-176927309 TGGTGCAGAGTATTTTAAAAGGG - Intergenic
967487585 3:190051905-190051927 GGGTGAAGAAGCCTTTCAAATGG - Intronic
968112569 3:196061171-196061193 GGCAGCAGAAAATTGACAAAAGG - Intronic
973734952 4:53862481-53862503 TGCTGGAGAAAATTTTCACATGG + Intronic
973747809 4:53981333-53981355 GGCTGTGGAAAGTTTTCAAAAGG - Intronic
975261709 4:72309952-72309974 GGGTGGTGAAGATTTTCACAGGG + Intronic
976995951 4:91434100-91434122 GGCTGCACAAAATATTCAGAAGG + Intronic
977360363 4:95995928-95995950 GTCTGCTGAAAATATTCAAAGGG + Intergenic
977847709 4:101785712-101785734 GGTTGGAGAAAAATTTCAACAGG - Intronic
977943817 4:102887459-102887481 GTGTATAGAAAATTTTAAAATGG + Exonic
978191125 4:105913664-105913686 TGGTACAGCACATTTTCAAATGG + Intronic
979632596 4:122921031-122921053 TGGTGCAGCAGTTTTTCAAACGG - Intronic
981006245 4:139878499-139878521 AGGTGTAGAAAATTGTAAAATGG - Intronic
981896128 4:149802197-149802219 GACTGCAGAACATTTTTAAAAGG - Intergenic
982433254 4:155348681-155348703 TTGAGCAGAAAATTTACAAAAGG - Intronic
982502927 4:156180738-156180760 AGGTGCATAAAATTTTTCAAAGG + Intergenic
983230272 4:165122988-165123010 GAGTGCAGAAAAATTTAAACTGG - Intronic
984210882 4:176846283-176846305 GGATGCAGAAGGTTTTCAAAAGG + Intergenic
984551696 4:181168221-181168243 GAGTGCAGAAAATATTTAAGAGG - Intergenic
986420786 5:7579308-7579330 GGATGGATAAAATTTTAAAAAGG + Intronic
990994131 5:61713948-61713970 GGATGGAGCTAATTTTCAAATGG + Intronic
991009065 5:61863190-61863212 GGGTGTAGAAAGTTTTCAAAAGG - Intergenic
992023109 5:72644360-72644382 GGGAGCAGAAAGCTTTAAAAAGG - Intergenic
992670119 5:79051378-79051400 TGGTGCAGGATATTTTAAAAGGG + Exonic
992707951 5:79416812-79416834 AGCTGCTTAAAATTTTCAAAGGG - Intronic
993085156 5:83354991-83355013 AGGTGCAGACTTTTTTCAAAGGG - Intergenic
993097123 5:83492597-83492619 GGGCTCAAGAAATTTTCAAAGGG - Intronic
994702293 5:103150398-103150420 GGGTGAAGAAAATGGCCAAAAGG - Intronic
994836565 5:104862573-104862595 GGGTGTGGAAGATTTTCAAAAGG - Intergenic
995173078 5:109140116-109140138 GTGTGCACAGAATTTTAAAAAGG - Intronic
995604894 5:113842990-113843012 GGGTGCATAATATATTCTAAAGG + Intergenic
998820536 5:146053784-146053806 GGGTGGAGAAAAGTGACAAATGG + Intronic
999625292 5:153514071-153514093 GGGTTCAGAAGATTTTCATTTGG - Intronic
1003654384 6:7992337-7992359 CGGTGAAGAACATGTTCAAAGGG - Intronic
1004053843 6:12114357-12114379 GGGTTTAGAAACTTTTAAAAAGG - Intronic
1005170092 6:22974161-22974183 AGGTGTGGAAGATTTTCAAATGG + Intergenic
1005630637 6:27704352-27704374 GGGTTAAGAAAATTTGGAAAAGG - Intergenic
1007689034 6:43686623-43686645 GGGAGCAGAAAAGTCTAAAAAGG - Intronic
1009284543 6:61800189-61800211 GGGTGTAAAACTTTTTCAAAGGG + Intronic
1012286327 6:97393308-97393330 GAGTGGAGATAATTTTCAAAAGG + Intergenic
1012595339 6:101031995-101032017 GGGTTCAGGATATATTCAAAAGG - Intergenic
1013445267 6:110219957-110219979 AGTTGCAAAAAATATTCAAATGG - Intronic
1016449645 6:144168752-144168774 AAGTGTAGAAGATTTTCAAAAGG - Intronic
1017585392 6:155915838-155915860 GAGTGCAGAATATTTGCAACAGG - Intergenic
1018158803 6:161016604-161016626 GGGTGCCAAAAATATTCAATGGG - Intronic
1020435942 7:8162663-8162685 GAGTGAAGAAAATTTTAAAAGGG - Intronic
1021171407 7:17402216-17402238 TGGTGCAGAAAGTTGCCAAAAGG + Intergenic
1021830709 7:24605019-24605041 GGGTGCTGAAAATTGCCCAAAGG - Intronic
1022127351 7:27371345-27371367 AACTGCAGAAAATGTTCAAATGG - Intergenic
1022910912 7:34898883-34898905 GGGAGCAGAAAATGAACAAAAGG + Intergenic
1024134896 7:46396533-46396555 AGGTGCAGAAGAATTGCAAATGG + Intergenic
1024454459 7:49587609-49587631 GGGGGCCTAAAATTTTAAAACGG + Intergenic
1028551328 7:92070185-92070207 GAGTGCAGATACTTTTCAAAAGG + Exonic
1028553918 7:92102614-92102636 GAGGGCAGAAAGTTTTCGAAAGG + Exonic
1029344795 7:99970766-99970788 GGGATCTGAAGATTTTCAAAAGG - Intronic
1030080557 7:105774192-105774214 GTGGGAGGAAAATTTTCAAAGGG + Intronic
1031305062 7:120115628-120115650 GGGTAAAAAAAAGTTTCAAAAGG + Intergenic
1031713986 7:125084216-125084238 AGGTGCAGAAATTTTGCATAGGG - Intergenic
1032027505 7:128455465-128455487 GGGTGCACTAAATTGTCAGAGGG - Intergenic
1033629912 7:143147566-143147588 TGTTGCAGAAAATCTTCCAACGG + Intergenic
1036129306 8:6093702-6093724 GGGTGTAGGAAACCTTCAAAGGG - Intergenic
1037616042 8:20519811-20519833 GGTGGCAGAGAATTTTCAGATGG + Intergenic
1038201692 8:25418885-25418907 GGTTCCAGTAAACTTTCAAAGGG + Intergenic
1038789978 8:30659489-30659511 GGGCCCAGAAGATTTACAAAAGG + Intergenic
1039609398 8:38907138-38907160 TGCTCCAGAAAATATTCAAAAGG - Intronic
1040557460 8:48493640-48493662 GTCTGCAGAATGTTTTCAAAGGG + Intergenic
1040635049 8:49263487-49263509 GGATGCAGAAAATATTAAGATGG - Intergenic
1040750702 8:50702615-50702637 GTGTACTGAAAATTGTCAAAGGG - Intronic
1042070038 8:64922722-64922744 GGCTGCTGAATATTGTCAAATGG + Intergenic
1042416286 8:68523762-68523784 GGTTGGAGAAAATTTTTTAATGG + Intronic
1043630826 8:82330298-82330320 GGGTGGAGGAAATGTTAAAAAGG + Intergenic
1043678351 8:82990155-82990177 GGGTGTGGAAGATTTTCAAAAGG - Intergenic
1044255173 8:90051618-90051640 TGGTTCAGAAACTTTTTAAAAGG + Intronic
1044443646 8:92248756-92248778 GACTGCAGAAATTGTTCAAATGG + Intergenic
1044899965 8:96933964-96933986 GATTGCAGAAAATGTTCACAAGG + Intronic
1046343793 8:112895262-112895284 TGTTGCAGAAATTTTTTAAAGGG + Intronic
1047665363 8:127085918-127085940 GGGTGGAGAATTTTTTCAACTGG - Intergenic
1048667217 8:136675814-136675836 GGGTGAAGAGACTTTTAAAAAGG + Intergenic
1050377308 9:4985843-4985865 GTGTCTAGAAAATTTTAAAAAGG - Intronic
1050977346 9:11956946-11956968 GGGTGAATATAATTTTCAGATGG + Intergenic
1051074920 9:13222208-13222230 GAGTACCTAAAATTTTCAAAAGG - Intronic
1051893466 9:21965898-21965920 AGGTGGAGAAAATTTTCAGGGGG + Intronic
1052559799 9:30070531-30070553 GGGGGCAGAAGATGTACAAAGGG + Intergenic
1053540539 9:38969207-38969229 GAGTGCAGACAACTTTAAAAGGG + Intergenic
1053804885 9:41791363-41791385 GAGTGCAGACAACTTTAAAAGGG + Intergenic
1054140399 9:61524094-61524116 GAGTGCAGACAACTTTAAAAGGG - Intergenic
1055757109 9:79569937-79569959 AGGTTCAGAAAACTGTCAAAAGG + Intergenic
1055902000 9:81250704-81250726 GGGTGTAGAAGGTTTTCAAAAGG + Intergenic
1057262407 9:93592386-93592408 GGATGCAGATAATTTTAAACAGG - Intronic
1059238984 9:112786811-112786833 AGGTAAAGAAAATTTTAAAAAGG - Intronic
1059358437 9:113719434-113719456 TGGTGCAGAGAATGTTCAGAAGG - Intergenic
1060667729 9:125442825-125442847 GGCTGCAAAAGATTTTCAAAAGG - Intronic
1186341513 X:8650862-8650884 GGGTGAAAAACATTTTGAAAAGG + Intronic
1186366503 X:8900214-8900236 GGCTGGCGAAAATTTTCTAAAGG - Intergenic
1186732396 X:12423566-12423588 GGGTGCAGAAAGGTTTGCAAGGG + Intronic
1186828708 X:13368090-13368112 GGGTGCACAAAACTATCATACGG - Intergenic
1187114063 X:16331383-16331405 GGGTGCAGGATATTTTTAAAGGG - Intergenic
1187870867 X:23764190-23764212 AGTAGGAGAAAATTTTCAAAAGG - Intronic
1188976307 X:36680350-36680372 GAGTGCATTTAATTTTCAAAAGG + Intergenic
1189675175 X:43453969-43453991 AGGGGCAGTAAATTTTCTAAGGG - Intergenic
1190077132 X:47325512-47325534 GTGTGCAGCTAACTTTCAAATGG - Intergenic
1191732361 X:64351033-64351055 GGGTAGAAAACATTTTCAAATGG - Intronic
1192753069 X:74015141-74015163 GGATGCAAAAAGTTTTCAAATGG + Intergenic
1194884754 X:99299915-99299937 GAGTTCAAAAAATTTTCAACTGG + Intergenic
1195421533 X:104680390-104680412 GCTTTCATAAAATTTTCAAAGGG + Intronic
1195884216 X:109623516-109623538 GGGTGAAGAAAATGTTTATATGG - Intergenic
1195925858 X:110023844-110023866 GCTTGCAGAAAATTGGCAAATGG - Intronic
1197041654 X:121943810-121943832 GGGTGTAGAAAACATTCAATAGG - Intergenic
1198046370 X:132907230-132907252 GGGTACAGTAAATTATTAAAGGG + Intronic