ID: 928565218

View in Genome Browser
Species Human (GRCh38)
Location 2:32538638-32538660
Sequence GTACAGTGTATGGCTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 426}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928565218 Original CRISPR GTACAGTGTATGGCTGGGCA TGG Intronic
900346890 1:2214412-2214434 GTGCAGTGTATGGCAAGGCCTGG + Intergenic
901300908 1:8199620-8199642 GCAAAGGGTCTGGCTGGGCACGG + Intergenic
901326623 1:8370078-8370100 GAATAGTTTCTGGCTGGGCACGG - Intronic
901684738 1:10937615-10937637 GGGCAGTGTAGGGCTGGGCCCGG - Intergenic
901940322 1:12656848-12656870 ACTCAGTGTAAGGCTGGGCATGG + Intronic
902435866 1:16397818-16397840 GAGCAGGGTATGGCTGGGCAGGG - Exonic
902439399 1:16419647-16419669 GCAAGGTCTATGGCTGGGCATGG + Intronic
902984340 1:20146519-20146541 GCACAGAGTAGGGCAGGGCAGGG - Intronic
903133687 1:21295218-21295240 ATAAAGTGCTTGGCTGGGCATGG + Intronic
904670652 1:32162544-32162566 GTACAGGTTCTGGCTGGGCACGG + Intronic
905023944 1:34837162-34837184 GTACATTCTTGGGCTGGGCACGG + Intronic
905039165 1:34939587-34939609 GTATAGATTACGGCTGGGCATGG - Intergenic
905147211 1:35896287-35896309 GGACAGATTCTGGCTGGGCACGG - Intronic
905156799 1:35991010-35991032 AAACAGTATAAGGCTGGGCACGG + Intronic
905255969 1:36684764-36684786 GAAAAATGTATGGCCGGGCACGG - Intergenic
905416461 1:37807908-37807930 GTACAGCGTATCGGTGGGGACGG + Exonic
905611926 1:39360544-39360566 GTTCAATGTAGGACTGGGCATGG + Intronic
906177925 1:43791941-43791963 GCTCAGTGGATGGGTGGGCATGG + Intronic
907117557 1:51982461-51982483 AAAGAGTCTATGGCTGGGCATGG + Intronic
908124676 1:61018490-61018512 GCACAGTGTTGGGCTGGGCACGG - Intronic
909658442 1:78056184-78056206 GTAAAACTTATGGCTGGGCATGG + Intronic
911172244 1:94782276-94782298 CTACAGTGTAGGGCTTGGCAGGG - Intergenic
911796568 1:102084257-102084279 ATATAGTCAATGGCTGGGCACGG + Intergenic
911861293 1:102952385-102952407 ATACAGTATCTGGCTGGGCACGG - Intronic
912805197 1:112751232-112751254 ATACAGAGTATGGCCAGGCATGG - Intergenic
913957253 1:143317961-143317983 GGCCAGGGTATGGCAGGGCAGGG + Intergenic
914051567 1:144143325-144143347 GGCCAGGGTATGGCAGGGCAGGG + Intergenic
914127630 1:144823216-144823238 GGCCAGGGTATGGCAGGGCAGGG - Intergenic
914811480 1:151031952-151031974 ATACTGTGTATGGCTGGGTATGG + Intronic
915343165 1:155187173-155187195 GCAGAGGGTTTGGCTGGGCAAGG - Intronic
916790727 1:168122751-168122773 TTACATAGTATGGCTGGGGAAGG - Intronic
916854930 1:168739495-168739517 GTACAGTTTTTGGCCAGGCATGG + Intergenic
916889606 1:169103510-169103532 GTGGAGTGTGTGGCTGGGCGTGG - Intergenic
917018402 1:170560277-170560299 GAACAGACTATGGCTGGGCACGG + Intergenic
917550366 1:176020395-176020417 TTACACTGTAAGGCTGGGCATGG + Intronic
918148075 1:181775291-181775313 ATACAGTGAATGGGTGAGCAGGG + Intronic
918346016 1:183608004-183608026 ATACAGTAGTTGGCTGGGCACGG + Intergenic
918447454 1:184629601-184629623 GTACAGTGTATGCCAGGGCCTGG + Intergenic
919874887 1:201857503-201857525 TTTCAGTTTATGGCTGGGCGTGG + Intronic
920123844 1:203677949-203677971 GGACAGAGTAGGGCAGGGCAGGG + Intronic
920404151 1:205696631-205696653 GTACATTATGGGGCTGGGCATGG - Intergenic
920647549 1:207814535-207814557 GTGCAGTGTGTCCCTGGGCATGG - Intergenic
920877039 1:209846145-209846167 GTACATTTTCTGGCCGGGCACGG - Intronic
921055440 1:211539156-211539178 GTACAGGGTATGGTGGGGCCTGG + Intergenic
921810898 1:219512715-219512737 GTACATTCCAGGGCTGGGCAGGG + Intergenic
921862426 1:220053875-220053897 GTTCAGTACCTGGCTGGGCAAGG + Intergenic
922872056 1:228910883-228910905 ATACAGTTCAAGGCTGGGCACGG - Intergenic
923400011 1:233607795-233607817 GGAGAGTGCATGGCTGGGCTGGG + Intergenic
923799175 1:237190177-237190199 GAAAACAGTATGGCTGGGCACGG - Intronic
923898237 1:238296449-238296471 GGCCTGTGTATGGCTGGGAAAGG - Intergenic
924009173 1:239645241-239645263 CTACAGTGTCTGGCAGGGCTTGG - Intronic
924057857 1:240141658-240141680 TTAAAGTATATGGCTGGGCGTGG - Intronic
924675411 1:246171718-246171740 ATACAGTATAAGGTTGGGCATGG + Intronic
1065477150 10:26152123-26152145 GAACAGTGTCTGGTTGGCCAGGG + Intronic
1065504340 10:26414430-26414452 TTAAAGTGTATGTCTGGGCCAGG + Intergenic
1066207029 10:33199531-33199553 ATACAGATTTTGGCTGGGCATGG - Intronic
1066961192 10:42230113-42230135 GGCCAGGGTATGGCAGGGCAGGG + Intergenic
1066996643 10:42570359-42570381 GGACAGTGTAGGCCTGGGCCTGG - Intergenic
1067868069 10:49929535-49929557 ATACAGTTTTTGGCTGGGCGCGG + Intronic
1068064294 10:52109474-52109496 GTAAAATGTTTGGCTGGGCGTGG + Intronic
1069004738 10:63305076-63305098 TTGCAGTGAGTGGCTGGGCATGG + Intronic
1069050598 10:63788566-63788588 TTTCAGTGTTTGGCTGGGCTCGG + Intergenic
1069211775 10:65770591-65770613 TTACAATTTATGGCTGGGCACGG + Intergenic
1069543158 10:69310764-69310786 GTACATTGGTTGGCTGGGCCTGG + Intronic
1069803906 10:71105306-71105328 ATAAAATTTATGGCTGGGCATGG + Intergenic
1069966090 10:72118487-72118509 ATACACTTTCTGGCTGGGCATGG + Intronic
1071607351 10:87005402-87005424 GTACAAAAAATGGCTGGGCATGG + Intergenic
1073519166 10:104110203-104110225 GTACAGAGTATGGCTGGAGCAGG + Intergenic
1073923281 10:108483165-108483187 GTATATTGTTGGGCTGGGCATGG - Intergenic
1075374659 10:121969052-121969074 GTACAGAGCTTGGCCGGGCACGG + Intronic
1075760806 10:124854935-124854957 GTGCAGTTGAGGGCTGGGCAAGG - Intergenic
1076217464 10:128707576-128707598 TTACAATGTTTAGCTGGGCAGGG - Intergenic
1076354576 10:129842471-129842493 GTGCAATATCTGGCTGGGCACGG + Intronic
1077502272 11:2914777-2914799 GCTCAGGGTCTGGCTGGGCAGGG - Intronic
1077605319 11:3606611-3606633 ATAAAGTTTTTGGCTGGGCACGG - Intergenic
1077949793 11:6943983-6944005 GTGCATGGTATGGCTGGGCGTGG + Intronic
1078824120 11:14910659-14910681 ATACATGGTATGGCTGGGCATGG - Intronic
1079207004 11:18424715-18424737 GTACTATGTAATGCTGGGCATGG + Intronic
1079248772 11:18772436-18772458 GGACAGTGGACAGCTGGGCAAGG - Intronic
1079380875 11:19936157-19936179 GAACAGTTCATGGCTGGGCGCGG - Intronic
1080331459 11:31144425-31144447 GCACAGTCTTTGGCCGGGCACGG - Intronic
1081959896 11:47128163-47128185 GTACAGGCTAAGGCTGGGCATGG - Intronic
1082953700 11:58846499-58846521 GCACAGTATATCTCTGGGCACGG + Intronic
1082970107 11:59011755-59011777 GCACAGTCTATCTCTGGGCACGG + Intronic
1083212162 11:61194847-61194869 GTAGAGAGGAGGGCTGGGCATGG - Intergenic
1083294631 11:61708671-61708693 GTAAAGTGTGAGGCTGGGCGTGG - Intronic
1084903979 11:72331862-72331884 GTAGAGACTGTGGCTGGGCATGG - Intronic
1086926171 11:92642908-92642930 GTACAGTGCATGGCAGAGTAAGG - Intronic
1086951286 11:92892699-92892721 GCACAGTTTTGGGCTGGGCACGG - Exonic
1087030194 11:93695718-93695740 GTAAAATGGATGGCTGGGCGCGG + Intronic
1089375447 11:117990904-117990926 GTAAAGTGTTGGGCTGGGCTCGG + Intronic
1089488299 11:118864268-118864290 GTTCAGTTTTGGGCTGGGCATGG - Intergenic
1090051830 11:123386737-123386759 GTATAGTGTGAGGCTGGGCATGG - Intergenic
1090432394 11:126656894-126656916 ATACAGGGGTTGGCTGGGCATGG + Intronic
1092607351 12:10135195-10135217 GAAAAGATTATGGCTGGGCACGG + Intergenic
1093788118 12:23215923-23215945 GTAGTGTGTGAGGCTGGGCAGGG - Intergenic
1093937521 12:25017425-25017447 GTATATTCTCTGGCTGGGCATGG + Intergenic
1094226135 12:28048312-28048334 ATATAGGGTTTGGCTGGGCACGG + Intergenic
1094448345 12:30557914-30557936 ATTCAGTGAGTGGCTGGGCATGG - Intergenic
1095204332 12:39422249-39422271 GTACTGTTTGCGGCTGGGCATGG - Intronic
1096069846 12:48768817-48768839 GTTCTGTGTATGGTGGGGCAGGG - Intronic
1096310389 12:50515516-50515538 CCACAGTGTAGGGCTGGGCATGG - Intronic
1097440249 12:59599141-59599163 GTACAGTGTCTGGCATGTCATGG + Intronic
1097885203 12:64721977-64721999 GTAAAATGTATGGGTTGGCAAGG + Intronic
1097965139 12:65571147-65571169 GTACTGTGTGTAACTGGGCAGGG - Intergenic
1102273527 12:111561202-111561224 GAACAGTCTCTGGCCGGGCATGG + Intronic
1103111706 12:118285641-118285663 GTATAGATTATGGCTGGGCATGG - Intronic
1104252709 12:127110430-127110452 TTAAAGTCTATGGCTGGGCGCGG - Intergenic
1105994437 13:25656645-25656667 ATACATTTTCTGGCTGGGCATGG + Intronic
1107785106 13:43947587-43947609 GTAAATAATATGGCTGGGCAAGG - Intergenic
1108398480 13:50013826-50013848 GAGCAGTCTTTGGCTGGGCACGG - Intronic
1108821256 13:54353404-54353426 TTACAGTCTTTTGCTGGGCAGGG + Intergenic
1109927962 13:69171583-69171605 GTACTGTGTAGGGATGGGCCGGG - Intergenic
1110174333 13:72538093-72538115 TTACAGTGTATAGCTAGGTAAGG + Intergenic
1110218458 13:73048614-73048636 GAACAGTGCCTGACTGGGCATGG + Intergenic
1113288196 13:108876954-108876976 ATACAGTTAATGGCTGGGCGCGG - Intronic
1114546198 14:23503408-23503430 GTACACTGTGAGGCTGGGCATGG - Intronic
1115564500 14:34613500-34613522 ATACAGAATCTGGCTGGGCATGG + Intronic
1115675429 14:35668190-35668212 TTAAAATGTAAGGCTGGGCATGG + Intronic
1116828564 14:49695286-49695308 ATACATTTCATGGCTGGGCACGG - Intronic
1116924463 14:50619967-50619989 GAACTGGTTATGGCTGGGCACGG + Intronic
1117059755 14:51950028-51950050 GTAGAGTTCTTGGCTGGGCATGG - Intronic
1118053242 14:62051746-62051768 ATGCAGTTTTTGGCTGGGCATGG + Intronic
1119091031 14:71781502-71781524 ATAAAATTTATGGCTGGGCATGG + Intergenic
1120825661 14:88952628-88952650 GGACAGTGTCTGAATGGGCACGG - Intergenic
1122208823 14:100161777-100161799 ATAAAGTTTATGGCCGGGCATGG + Intergenic
1202931112 14_KI270725v1_random:32084-32106 GGCCAGGGTATGGCAGGGCAGGG - Intergenic
1123421315 15:20139594-20139616 GGCCAGAGTATGGCAGGGCAGGG + Intergenic
1123443814 15:20307197-20307219 GGCCAGAGTATGGCAGGGCAGGG - Intergenic
1123530541 15:21146134-21146156 GGCCAGAGTATGGCAGGGCAGGG + Intergenic
1123979647 15:25589155-25589177 GTGCAGTGTATGGATGTGGAAGG - Intergenic
1124914969 15:33961297-33961319 ATATATTTTATGGCTGGGCATGG - Intronic
1125849822 15:42892414-42892436 ATAAAATGTTTGGCTGGGCACGG + Intronic
1126482465 15:49141209-49141231 TTACAGTTTTTGGCTGGGCTTGG + Intronic
1127249129 15:57211661-57211683 ATACAATTTAAGGCTGGGCATGG + Intronic
1127513210 15:59664669-59664691 AGAAAGTTTATGGCTGGGCACGG - Intronic
1127873625 15:63093598-63093620 GTACAGTGTATCCCTGGGGAAGG - Intergenic
1129305029 15:74653960-74653982 CTGCAGTGTAGGGCTGGGCGCGG + Intronic
1129613483 15:77080189-77080211 CTACTGTTTTTGGCTGGGCACGG + Intronic
1130865340 15:87929059-87929081 GTTGAGTGCATGTCTGGGCATGG + Intronic
1131979847 15:97984374-97984396 ATACAATCTCTGGCTGGGCATGG + Intergenic
1132086761 15:98914623-98914645 CTACAGTGAATTGCTGGCCAGGG - Intronic
1132699345 16:1215732-1215754 GTGCAGTGCATGGCTTGGCTGGG + Intronic
1132711960 16:1272801-1272823 GCACTGGGCATGGCTGGGCAGGG + Intergenic
1133307255 16:4818281-4818303 GTAAAGTGTGAGGCCGGGCATGG - Intronic
1133477562 16:6138205-6138227 GTGCAGGGTGTGGCTGGGCAGGG - Intronic
1133968633 16:10550682-10550704 ATACTTTGTAAGGCTGGGCATGG + Intronic
1134042288 16:11077826-11077848 GTACAGAATATGGCTAGGCGCGG + Intronic
1134125115 16:11611063-11611085 ATACAGTACATGGCTAGGCATGG + Intronic
1134463894 16:14456123-14456145 GTACAGTGTGGGGCTGGGTAAGG - Intronic
1135085550 16:19472049-19472071 GTCAAGTTTATGGCTGGGCATGG - Intronic
1136471126 16:30481009-30481031 GTAGAGTTTGGGGCTGGGCACGG + Intronic
1136474075 16:30501283-30501305 TTAAAATGTTTGGCTGGGCACGG + Intronic
1136509289 16:30725913-30725935 GTACAGTTTAGGGCCAGGCATGG - Intronic
1136669364 16:31842311-31842333 GGGCAAAGTATGGCTGGGCACGG + Intergenic
1136722393 16:32336663-32336685 GGCCAGGGTATGGCAGGGCAGGG + Intergenic
1136840707 16:33542635-33542657 GGCCAGGGTATGGCAGGGCAGGG + Intergenic
1137283495 16:46997761-46997783 ATCCAGTCTATGACTGGGCATGG - Intergenic
1137897117 16:52225800-52225822 CTACAGTGTTTTGCTGGGCGCGG - Intergenic
1140135617 16:72203035-72203057 CTACAGTGTGTGGCTGGCTAGGG + Intergenic
1140396251 16:74629366-74629388 TTGCTGTGTTTGGCTGGGCATGG + Intronic
1141504280 16:84464319-84464341 ATAAAGAGTAGGGCTGGGCATGG + Intergenic
1203004038 16_KI270728v1_random:181101-181123 GGCCAGGGTATGGCAGGGCAGGG - Intergenic
1203135646 16_KI270728v1_random:1717508-1717530 GGCCAGGGTATGGCAGGGCAGGG - Intergenic
1203150872 16_KI270728v1_random:1842932-1842954 GGCCAGGGTATGGCAGGGCAGGG + Intergenic
1142843619 17:2654095-2654117 GTATAGTGACTGGCCGGGCATGG - Intronic
1142946643 17:3435033-3435055 CCACAGTGTGTGGCCGGGCACGG - Intergenic
1143687648 17:8531679-8531701 ATAGAGTTTATGGCTGGGCACGG - Intronic
1143891850 17:10108024-10108046 GTCCAGTGGAGGGCTTGGCAGGG + Intronic
1145244746 17:21261194-21261216 GTACTGTTTATGGCTGGGCATGG + Intergenic
1145832035 17:27924249-27924271 GATGTGTGTATGGCTGGGCACGG + Intergenic
1146224224 17:31051887-31051909 TTTGAGTGTATGGCTAGGCAGGG - Intergenic
1146797014 17:35788867-35788889 GGACAGTGTCTGGCTTGGAATGG + Intronic
1146972714 17:37085680-37085702 GGGCACTGTATGGCTGGGTATGG - Exonic
1147749510 17:42720939-42720961 ATAAAGCCTATGGCTGGGCACGG - Intronic
1147969392 17:44211475-44211497 ATACAGTGTGGGGCTGGGCTGGG - Intronic
1148659923 17:49321558-49321580 ACACACTGTGTGGCTGGGCACGG - Intronic
1149718014 17:58812855-58812877 AAAAAGTGTGTGGCTGGGCACGG - Intronic
1150817344 17:68402813-68402835 GTACAGGATCAGGCTGGGCAAGG - Intronic
1151686839 17:75652492-75652514 GAGCAGGGTACGGCTGGGCAGGG + Intronic
1151713504 17:75819786-75819808 GTACTGGGTGTGGGTGGGCAGGG + Intronic
1151932007 17:77238404-77238426 AAACAGTGTCTGGCTGGACACGG - Intergenic
1151947870 17:77329378-77329400 GGGCAGTGCAAGGCTGGGCAGGG - Intronic
1152173852 17:78773121-78773143 GTTCAGTTTCAGGCTGGGCATGG - Intronic
1152534114 17:80940698-80940720 GGACAGTGGATGGCTGGAGAAGG - Intronic
1152750335 17:82059625-82059647 GTCCTGTGTGAGGCTGGGCAGGG + Intronic
1153371013 18:4316325-4316347 CTATAGTGTACGGCTGTGCATGG - Intronic
1153535646 18:6098843-6098865 GTACTGTGTCTGGGTGGGCCGGG + Intronic
1154414735 18:14170872-14170894 GGGCAGTGTTGGGCTGGGCAGGG + Intergenic
1154981248 18:21504242-21504264 GTACCATCTCTGGCTGGGCAGGG + Intronic
1155013446 18:21806909-21806931 ATACATTATTTGGCTGGGCACGG - Intronic
1155143262 18:23062556-23062578 ATACTGTATAGGGCTGGGCACGG + Intergenic
1155988985 18:32259742-32259764 GTACATTTCATGGCTGGGCGTGG + Intronic
1156812093 18:41264942-41264964 ATGCAGTGTATGGCTTGGCATGG - Intergenic
1156865902 18:41888401-41888423 AGCCAGTGTCTGGCTGGGCATGG + Intergenic
1157090226 18:44628023-44628045 CTACAGTGGATGTCTGGGCAGGG - Intergenic
1157185956 18:45540246-45540268 GAACAGGATGTGGCTGGGCAAGG - Intronic
1157240896 18:46008595-46008617 ATACAGCTTAAGGCTGGGCAAGG - Intronic
1157889711 18:51404109-51404131 CCACAGTGGATGGCCGGGCACGG - Intergenic
1157931271 18:51825996-51826018 GTGGAGTGTATGTATGGGCAAGG + Intergenic
1158353320 18:56587754-56587776 GTTAATTATATGGCTGGGCATGG - Intergenic
1158410598 18:57202189-57202211 TTACAGTGTATGGCTTTACAAGG - Intergenic
1159254467 18:65928620-65928642 GTAGAATTTTTGGCTGGGCATGG + Intergenic
1160230974 18:77048752-77048774 CTACAGAGATTGGCTGGGCATGG - Intronic
1160826311 19:1082107-1082129 GGACAGTGCCTGGCAGGGCAGGG + Intronic
1161394620 19:4038481-4038503 GTACAGTGGGCGGCTGGGGAGGG + Exonic
1161833014 19:6623574-6623596 CTTCAGTCCATGGCTGGGCATGG + Intergenic
1162460486 19:10811409-10811431 GTGCAGGGCATGGCAGGGCACGG - Intronic
1162463456 19:10826958-10826980 ACACAGGGTGTGGCTGGGCATGG + Intronic
1162693980 19:12457451-12457473 TTAAAGTTTTTGGCTGGGCATGG + Exonic
1162888098 19:13711444-13711466 GAACATTCTCTGGCTGGGCACGG - Intergenic
1163083162 19:14958118-14958140 TTGAAGTTTATGGCTGGGCATGG + Intronic
1163543442 19:17925903-17925925 GTCCACTTTATGGCTGGGCATGG - Intergenic
1163918650 19:20266322-20266344 ACACAGTGTATGGCCGGGCGTGG - Intergenic
1164116444 19:22224699-22224721 GTACATTTTATGGCCAGGCATGG + Intergenic
1164240301 19:23381748-23381770 GTTCAGTTTATGGCTGGGCGCGG - Intronic
1164671323 19:30073714-30073736 TTACACTGTCTGGCTGAGCAGGG + Intergenic
1165281223 19:34799291-34799313 GTATAGTATGAGGCTGGGCATGG - Intergenic
1166104984 19:40593532-40593554 CTAGAGTGTGAGGCTGGGCATGG - Intronic
1167082838 19:47289018-47289040 AGAGAGTTTATGGCTGGGCAAGG + Intergenic
1167228739 19:48267993-48268015 GTAAAATGTATGGCTGGGCATGG - Intronic
1168080685 19:54008066-54008088 CCACAGTGAATGGCTGGGCACGG + Intronic
1168699857 19:58431232-58431254 GTACAATCTTTGGCAGGGCAAGG + Intergenic
1202690964 1_KI270712v1_random:95749-95771 GGCCAGGGTATGGCAGGGCAGGG + Intergenic
925194384 2:1911644-1911666 GTACAGTGTGTAGCTTGGCTTGG - Intronic
926147610 2:10406230-10406252 GAACAGTGTGTGCCAGGGCATGG - Intronic
926169440 2:10542712-10542734 TTACATTTTTTGGCTGGGCATGG - Intergenic
926240114 2:11078989-11079011 ATACATTGCATGGCTGGGCGTGG - Intergenic
927028994 2:19101000-19101022 GTTCAGTGTTTTCCTGGGCAGGG + Intergenic
927248133 2:20974436-20974458 ATACAGTTTCTGGCTGGGCGCGG + Intergenic
928565218 2:32538638-32538660 GTACAGTGTATGGCTGGGCATGG + Intronic
928820198 2:35352634-35352656 GTTCACTGTTTGGCTGGGCGCGG - Intergenic
929203061 2:39258220-39258242 ATAAAGGATATGGCTGGGCATGG - Intronic
930110202 2:47672475-47672497 ATACTTTATATGGCTGGGCACGG + Intergenic
931619566 2:64196234-64196256 GTAAAGTCTATGTCTGGGAATGG + Intergenic
931745130 2:65285277-65285299 CAAGAGTATATGGCTGGGCACGG - Intergenic
932059767 2:68484396-68484418 ATGCAGTTTAGGGCTGGGCACGG + Intronic
933955430 2:87358202-87358224 GGCCAGGGTATGGCAGGGCAGGG - Intergenic
933973467 2:87489238-87489260 GTCTAGTGCAAGGCTGGGCATGG - Intergenic
934239615 2:90254413-90254435 GGCCAGGGTATGGCAGGGCAGGG - Intergenic
934273578 2:91562327-91562349 GGTCAGGGTATGGCAGGGCAGGG + Intergenic
934462056 2:94217753-94217775 GGCCAGGGTATGGCAGGGCAGGG - Intergenic
935062921 2:99623674-99623696 ATGCAGTGGGTGGCTGGGCAGGG - Intronic
935140346 2:100347926-100347948 GTACAGGGCAAGGCTGGCCATGG + Intergenic
936146902 2:109986478-109986500 CTCCAGTGTCGGGCTGGGCAAGG - Intergenic
936197790 2:110385005-110385027 CTCCAGTGTCGGGCTGGGCAAGG + Intergenic
936320258 2:111460975-111460997 GTCTAGTGCAAGGCTGGGCATGG + Intergenic
936495532 2:113017356-113017378 GTACAAATCATGGCTGGGCACGG + Intergenic
937344200 2:121113514-121113536 ATACAGTATATAGCTGGGCATGG + Intergenic
937398076 2:121556274-121556296 GGACATTCTGTGGCTGGGCATGG - Intronic
938137725 2:128772921-128772943 GCTCAGTGGAAGGCTGGGCAGGG + Intergenic
938838946 2:135139248-135139270 GTACAGATCTTGGCTGGGCATGG + Intronic
939923663 2:148147528-148147550 GTTCAGTTTGGGGCTGGGCATGG - Intronic
940350180 2:152675920-152675942 AAGCAGTTTATGGCTGGGCATGG - Intronic
942177797 2:173351270-173351292 ATACATTTCATGGCTGGGCACGG - Intergenic
942266715 2:174234752-174234774 GTACAGTTGAGGGCTGGGCATGG - Intronic
942405036 2:175645125-175645147 AGACAGTGTGTGGCTGGGCGCGG - Intergenic
942538242 2:176988295-176988317 GCACAGTGTATCTCTGGGCAAGG - Intergenic
942994677 2:182246700-182246722 TAACAGGGTAAGGCTGGGCATGG - Intronic
943049742 2:182900483-182900505 TTACTGTATATGGCTGGGCGTGG + Intergenic
943855335 2:192783158-192783180 GTACTGTTAGTGGCTGGGCACGG + Intergenic
944157844 2:196626497-196626519 GTCTAGAATATGGCTGGGCATGG - Intergenic
944843285 2:203643932-203643954 GTGCAGTGTGGAGCTGGGCATGG - Intergenic
945082917 2:206104182-206104204 GCCAAGTGTGTGGCTGGGCACGG - Intergenic
947511314 2:230756979-230757001 ATACAGTTAAAGGCTGGGCATGG - Intronic
947927690 2:233936059-233936081 GCACAGTGTTTCGCTGGGCCTGG - Intronic
948464338 2:238145019-238145041 GCCCAGTGCTTGGCTGGGCAGGG - Intronic
948946667 2:241224010-241224032 GCACAGTGGGCGGCTGGGCAGGG - Intronic
948972965 2:241443514-241443536 GTACGCTGGATGGGTGGGCAGGG - Intronic
1168854973 20:1002063-1002085 GTACAAGGGGTGGCTGGGCAGGG - Intronic
1169377954 20:5082163-5082185 TTTCAGTGAATGGCTGGGCGTGG - Intronic
1169894007 20:10482969-10482991 GAACAGTGAATGGCTGGGACTGG - Intronic
1171485516 20:25482731-25482753 ATGCAGAGTATGGCCGGGCATGG + Intronic
1172402836 20:34664697-34664719 AAAAAGTATATGGCTGGGCATGG + Intronic
1172545247 20:35755815-35755837 ATAGAATATATGGCTGGGCATGG - Intergenic
1172691215 20:36791572-36791594 GTCCAGTCTATGGCTGGGAGTGG - Intronic
1173461840 20:43249091-43249113 ATGCATAGTATGGCTGGGCATGG - Intergenic
1174765336 20:53248362-53248384 GAAAAGTTAATGGCTGGGCATGG - Intronic
1174906005 20:54552116-54552138 TAATACTGTATGGCTGGGCAAGG - Intronic
1175118648 20:56701910-56701932 ATAAAGTGTGGGGCTGGGCACGG - Intergenic
1176419561 21:6503324-6503346 GAACTGTGGATGGCTGGGCGTGG - Intergenic
1176593135 21:8660706-8660728 GGCCAGGGTATGGCAGGGCAGGG - Intergenic
1176857601 21:13984950-13984972 GTCCAGGGCAAGGCTGGGCAGGG - Intergenic
1176858285 21:13987382-13987404 GGGCAGTGTTGGGCTGGGCAGGG - Intergenic
1177489351 21:21802620-21802642 TTATAGTTTAGGGCTGGGCATGG + Intergenic
1177531365 21:22362020-22362042 GTACAGTGTTTGGCAGTGAATGG - Intergenic
1177793611 21:25748194-25748216 AAACTGTGTACGGCTGGGCATGG - Intronic
1178307686 21:31504052-31504074 GTTCACTGTAAGGTTGGGCAGGG - Intronic
1179399306 21:41069500-41069522 GTAAATTGTAGGGCTGGGCATGG + Intergenic
1179695054 21:43111647-43111669 GAACTGTGGATGGCTGGGCGTGG - Intergenic
1179804440 21:43828011-43828033 GTGCTGTGGCTGGCTGGGCATGG + Intergenic
1180275981 22:10637833-10637855 GGCCAGGGTATGGCAGGGCAGGG - Intergenic
1180550484 22:16532811-16532833 GGCCAGGGTATGGCAGGGCAGGG - Intergenic
1181296166 22:21841114-21841136 ATATAATTTATGGCTGGGCACGG - Intronic
1181354183 22:22289000-22289022 GGCCAGGGTATGGCAGGGCAGGG + Intergenic
1182376116 22:29849442-29849464 GTACAAGATGTGGCTGGGCATGG - Intergenic
1182430895 22:30298375-30298397 GTAGAGTGTCTGGCTGGGGTAGG - Intronic
1182513335 22:30836006-30836028 ATACAATTAATGGCTGGGCATGG - Intronic
1182689483 22:32148285-32148307 GTAATATATATGGCTGGGCACGG + Intergenic
1183342314 22:37288254-37288276 ATACAGAGATTGGCTGGGCATGG + Intronic
1183895995 22:40969457-40969479 GTAAAGAGTATGGCTGGGCTTGG + Intronic
949694759 3:6681456-6681478 GTCCAAAGTATGGCTGGGCATGG - Intergenic
950514256 3:13453873-13453895 GTAAAGATTCTGGCTGGGCACGG + Intergenic
950832770 3:15891584-15891606 ATGCTGTATATGGCTGGGCATGG + Intergenic
950940608 3:16886591-16886613 GCGCAGTTTATGTCTGGGCAAGG + Intronic
952283069 3:31941982-31942004 ATGCAATGTATGGCAGGGCACGG + Intronic
952372197 3:32733468-32733490 GTACAGTCTATTGTTGGTCAAGG + Exonic
952725952 3:36584675-36584697 GTACAATGACTGGCTAGGCATGG + Intergenic
953443951 3:42946481-42946503 AGTCAGTTTATGGCTGGGCATGG + Intronic
953519364 3:43626589-43626611 GTAAAGAACATGGCTGGGCATGG - Intronic
953956333 3:47234844-47234866 TGAAAGTATATGGCTGGGCACGG - Intronic
953975452 3:47378793-47378815 GTAAACTTTGTGGCTGGGCACGG - Intergenic
954383921 3:50234641-50234663 GTACACATTTTGGCTGGGCATGG - Intronic
954718817 3:52542328-52542350 GCTGGGTGTATGGCTGGGCATGG + Intronic
955264621 3:57429464-57429486 GTGAAGAGGATGGCTGGGCACGG - Intronic
957498775 3:81026286-81026308 GTAGATTTTAAGGCTGGGCACGG + Intergenic
957806198 3:85152665-85152687 TTAAAATGTAAGGCTGGGCACGG + Intronic
961380073 3:126491368-126491390 GGACAGTGCTTGGCTGAGCATGG - Intronic
962588822 3:136868204-136868226 TTACAATGTAAGGCTGGGCATGG - Intronic
962600226 3:136985963-136985985 GAACAATGTTAGGCTGGGCATGG + Intronic
963115218 3:141723180-141723202 GTAAAGTGTGTGTCAGGGCATGG + Intergenic
963316736 3:143766862-143766884 TTGCAGTCTAAGGCTGGGCATGG - Intronic
964241902 3:154604077-154604099 GTATAGTGTATTCCTGGCCATGG + Intergenic
964263430 3:154867236-154867258 GGAAAGAGTCTGGCTGGGCAGGG + Intergenic
965533378 3:169799361-169799383 GTTCAGAGTTTGGCTGGGCATGG + Intronic
966021618 3:175218959-175218981 ATAAAATGAATGGCTGGGCACGG - Intronic
966680560 3:182637819-182637841 GAACAGGGCATGGCAGGGCAGGG - Intergenic
966709714 3:182958480-182958502 GTACACTGTATGGCTGTGGGGGG + Intronic
967001967 3:185344477-185344499 GTATAGTGTATAGCAGAGCAGGG - Intronic
967307870 3:188076448-188076470 GTGCAGCTGATGGCTGGGCAGGG + Intergenic
967323296 3:188215013-188215035 GTACAGTTCAAGCCTGGGCATGG + Intronic
967547198 3:190745270-190745292 GTACAGTGTGAGGCCAGGCACGG - Intergenic
967926523 3:194653222-194653244 GGACAGAGGATGGCTGGGCGTGG + Intronic
969920734 4:10537185-10537207 ATACAGCCTCTGGCTGGGCACGG + Intronic
969934899 4:10670577-10670599 GCACAGTGCATGGCAGGGCTGGG - Intronic
969946404 4:10787853-10787875 GTCTAGTGTTGGGCTGGGCATGG + Intergenic
970281737 4:14464200-14464222 GTACAGTGCAGGGCTGGGTGCGG - Intergenic
970581711 4:17479177-17479199 GCACATTGGAAGGCTGGGCATGG - Intronic
971020602 4:22531295-22531317 GGACAGAGTGTAGCTGGGCATGG - Intergenic
971453610 4:26822968-26822990 GTACAGTCTACTCCTGGGCAGGG - Intergenic
973944986 4:55946751-55946773 GCACGGTGGCTGGCTGGGCATGG + Intergenic
974004590 4:56543400-56543422 ATAAAGTTTAGGGCTGGGCATGG + Intronic
975038894 4:69720075-69720097 GTGGACTTTATGGCTGGGCATGG + Intergenic
976169735 4:82290951-82290973 GAACAGTGGCTGGCTGGGCATGG + Intergenic
976429159 4:84943209-84943231 ATACAGTATATGGCTGGGTGTGG + Intronic
978057859 4:104294986-104295008 GTACCAGGAATGGCTGGGCATGG - Intergenic
978705742 4:111708291-111708313 ATACAGTTTTTGGCCGGGCATGG - Intergenic
979304564 4:119127472-119127494 GTACAGTTTTGGGCCGGGCACGG - Intergenic
979759783 4:124388229-124388251 GTACAATGGTTGGCTGGGCTTGG - Intergenic
980601359 4:135029689-135029711 GTAAATTGTAAGTCTGGGCATGG + Intergenic
981278185 4:142926671-142926693 GCAATGTGTATGGCAGGGCAGGG + Intergenic
981370860 4:143957177-143957199 ATAGACTGGATGGCTGGGCATGG - Intergenic
984908674 4:184651936-184651958 TTAAAATGTTTGGCTGGGCACGG - Intronic
985251046 4:188024753-188024775 GTAAAGAGTTAGGCTGGGCATGG - Intergenic
986224946 5:5803653-5803675 TTACAGAGGGTGGCTGGGCACGG - Intergenic
987954704 5:24723496-24723518 TTAAAGTATATAGCTGGGCATGG + Intergenic
988579039 5:32453177-32453199 GAACAGTTCATGGCTGGGCACGG - Intergenic
988811406 5:34788677-34788699 ATACCATGTTTGGCTGGGCATGG + Intronic
989047436 5:37286401-37286423 GTTCGGGTTATGGCTGGGCACGG - Intergenic
990079239 5:51892221-51892243 ATACAGTATGTGGCTGGGCGTGG + Intergenic
991721524 5:69498201-69498223 ATTCAGTTTATGGCTGGGCATGG + Intronic
992575460 5:78106165-78106187 TTAGTGTGTGTGGCTGGGCACGG + Intronic
992674037 5:79087887-79087909 GTGAAATGTAAGGCTGGGCATGG + Intronic
993906319 5:93627728-93627750 ATACATTTTGTGGCTGGGCATGG - Intronic
996062428 5:119047074-119047096 GTACTGAGTAAGGCTGGGCGTGG + Intronic
996090800 5:119349817-119349839 ATAGAGTTTATGGCTGGCCATGG - Intronic
997328030 5:133038155-133038177 GTTCCATGTATGGCTGGGCATGG + Intergenic
998991862 5:147825729-147825751 TTAAAGAGTTTGGCTGGGCATGG - Intronic
999849660 5:155524515-155524537 ATGCACTGTCTGGCTGGGCACGG + Intergenic
1000002536 5:157152575-157152597 GTAGAGTGGTTGGCTGGGCACGG - Intronic
1000471095 5:161643130-161643152 AGACACTATATGGCTGGGCATGG + Intronic
1001365549 5:171134976-171134998 GAAAAGTTTAAGGCTGGGCATGG + Intronic
1001819265 5:174696854-174696876 TTACAGTGTACTGCTGGGCGCGG - Intergenic
1001893989 5:175363038-175363060 GCAGAGTGGATGGCTGGGAAGGG + Intergenic
1002166032 5:177346791-177346813 TTTCTGTGTATGGCTGGGCAAGG - Intronic
1002389697 5:178900336-178900358 GGACACTGTCTGGCTGGGGAGGG - Intronic
1002389731 5:178900477-178900499 GGACACTGTCTGGCTGGGGAGGG - Intronic
1002389754 5:178900571-178900593 GGACACTGTCTGGCTGGGGAGGG - Intronic
1004119738 6:12809176-12809198 AGACAGTAGATGGCTGGGCATGG - Intronic
1005611936 6:27534415-27534437 ATACACTATGTGGCTGGGCAAGG - Intergenic
1008505465 6:52225632-52225654 GCACAGTGTGTGCATGGGCACGG - Intergenic
1008509456 6:52262646-52262668 ATAAAGTGTACAGCTGGGCACGG - Intergenic
1010561350 6:77355169-77355191 ATACAGAGTAGGGCTGGGAAGGG + Intergenic
1015752300 6:136572545-136572567 TTTCAGTTTAGGGCTGGGCATGG - Intronic
1016115043 6:140270603-140270625 GCAGAGTCTATGGCTGGACAGGG - Intergenic
1016975126 6:149800173-149800195 GTAAGGTTTCTGGCTGGGCATGG + Intronic
1017145001 6:151226645-151226667 GGACAGTCTTTGGCTGGGCACGG - Intergenic
1017765654 6:157604832-157604854 GCACTGTGTAGGGCTGGGCATGG - Intronic
1017864663 6:158432570-158432592 AAGCAGTGCATGGCTGGGCACGG + Intronic
1018129769 6:160717959-160717981 ATTCATTGTAGGGCTGGGCACGG + Intronic
1018492757 6:164312595-164312617 GTAAAATGTTTGGCTGGGCACGG + Intergenic
1018592161 6:165438587-165438609 GTACATTTTATGACTTGGCAAGG + Intronic
1021969109 7:25950527-25950549 GTACTGGGAATGGCTGGGGAAGG - Intergenic
1022266085 7:28756260-28756282 GTACATTGAGTGGCTGGGCACGG + Intronic
1022270536 7:28803466-28803488 ATACAGTGGCTGGCCGGGCACGG + Intronic
1023957555 7:44899085-44899107 TTTCTGTATATGGCTGGGCATGG - Intergenic
1024583773 7:50823477-50823499 GCACAGTGGATGGAAGGGCAGGG - Intergenic
1024645162 7:51364773-51364795 GTATATTCTAAGGCTGGGCATGG + Intergenic
1024927347 7:54631291-54631313 GCACAATCTATGGCTGGGCATGG + Intergenic
1025201546 7:56965101-56965123 AGTCAGGGTATGGCTGGGCATGG + Intergenic
1025670398 7:63611829-63611851 AGTCAGGGTATGGCTGGGCATGG - Intergenic
1026820120 7:73541755-73541777 GTACTGGGTATGGCTGGGCGTGG - Intronic
1027525166 7:79260062-79260084 GTGCAGTACAAGGCTGGGCATGG + Intronic
1028196074 7:87909772-87909794 TAACAGTGTCTGGCTGGGCGCGG + Intergenic
1029654046 7:101912798-101912820 CGACAGGGTATTGCTGGGCATGG + Intronic
1030027051 7:105334545-105334567 GTATACAGTTTGGCTGGGCACGG + Intronic
1030167856 7:106572492-106572514 GAAAAGTGAAGGGCTGGGCATGG - Intergenic
1030352409 7:108504784-108504806 ATACTGTGTCTGGCTGGGCATGG + Intronic
1030652895 7:112134427-112134449 GTAAACTTAATGGCTGGGCACGG + Intronic
1031273340 7:119684067-119684089 GAACAGTGTATGCCAAGGCATGG + Intergenic
1032015190 7:128375285-128375307 ATAAAGTGTTAGGCTGGGCATGG + Intergenic
1032544720 7:132732081-132732103 GTGCCGTGTCTGTCTGGGCATGG - Intergenic
1034779069 7:153860455-153860477 GTTCAGGGAATGGGTGGGCAGGG - Intergenic
1035183477 7:157107935-157107957 GTCCAGAGTTTGGTTGGGCATGG + Intergenic
1035410890 7:158640252-158640274 GTACAGAGAGTGGCCGGGCACGG + Exonic
1035602112 8:902866-902888 GGAAAGTGTGTGGGTGGGCAGGG + Intergenic
1035602164 8:902994-903016 GGAAAGTGTGTGGGTGGGCAGGG + Intergenic
1036700367 8:11009218-11009240 GTATAGGGTTTGGCCGGGCATGG + Intronic
1037499145 8:19468940-19468962 GCACAGTGCATGGATGTGCAAGG + Intronic
1037946322 8:22991720-22991742 GTAAGGGGGATGGCTGGGCAGGG + Intronic
1038258995 8:25977201-25977223 GTACAGTGAAGGGCAGGGCGGGG + Intronic
1039024401 8:33242043-33242065 TAGCAGTGTCTGGCTGGGCAGGG + Intergenic
1039033119 8:33331049-33331071 ATACTGAGTAGGGCTGGGCATGG + Intergenic
1039924894 8:41920816-41920838 GGACAGTGTGTGGCCAGGCATGG + Intergenic
1039946711 8:42135966-42135988 GTACAGTAAATGGCTGGGTGCGG + Intergenic
1041246232 8:55891017-55891039 TTCCATTGTATGGCTGGGCACGG - Intronic
1041955639 8:63555800-63555822 GAACAGTTTTAGGCTGGGCATGG - Intergenic
1042061069 8:64818366-64818388 GTGAAGTGTAAGGCCGGGCATGG - Intergenic
1042120238 8:65479517-65479539 GTACAGTGTCTGGCAAGGGATGG - Intergenic
1042141791 8:65686628-65686650 TAACTGAGTATGGCTGGGCACGG + Intronic
1042529857 8:69803696-69803718 CTAAAGTGTATGGCTGGGTGTGG + Intronic
1042550564 8:69990786-69990808 GATCAGTGTGTGGCTGGGCATGG + Intergenic
1042671662 8:71270828-71270850 GTAGATTTTATGGCTGGGCGTGG + Intronic
1043239428 8:77914138-77914160 GTAAAATCTATGGCTGGGAAGGG + Intergenic
1043971970 8:86539953-86539975 CTACAGAGGATGGCTGGGCGCGG - Intronic
1044257950 8:90088136-90088158 GCACAGTCTATACCTGGGCAAGG - Intronic
1044262049 8:90136843-90136865 GTGCTGTTTCTGGCTGGGCACGG + Intergenic
1044640981 8:94381371-94381393 GAACACTGTATGGATAGGCAGGG - Intronic
1044645852 8:94442281-94442303 GTACAGTTAAAAGCTGGGCACGG + Intronic
1045253931 8:100503426-100503448 GTTCAGTGCAGGGCTGGGGAAGG - Intergenic
1045279542 8:100737994-100738016 ATAAAGTTTTTGGCTGGGCACGG - Intergenic
1047249806 8:123173541-123173563 ATACAGAATATGGCGGGGCATGG - Intergenic
1047274979 8:123398970-123398992 ATACTATTTATGGCTGGGCACGG + Intronic
1047410503 8:124620884-124620906 GTATCGTGAATGGCTGGACAGGG + Intronic
1047950039 8:129924984-129925006 GTACTGTGTAGGGCTGAGCTGGG - Intronic
1051265059 9:15302030-15302052 GTTAAGTGTAAGGTTGGGCACGG + Intronic
1052924666 9:34004810-34004832 GTAAATTTTAAGGCTGGGCACGG + Intronic
1053692533 9:40593436-40593458 GGCCAGGGTATGGCAGGGCAGGG - Intergenic
1054272284 9:63044097-63044119 GGCCAGGGTATGGCAGGGCAGGG + Intergenic
1054303775 9:63394354-63394376 GGCCAGGGTATGGCAGGGCAGGG - Intergenic
1054402553 9:64720864-64720886 GGCCAGGGTATGGCAGGGCAGGG - Intergenic
1054436164 9:65205195-65205217 GGCCAGGGTATGGCAGGGCAGGG - Intergenic
1054494228 9:65816492-65816514 GGCCAGGGTATGGCAGGGCAGGG + Intergenic
1055483618 9:76734756-76734778 GAACAGAGTATGGCTAGGCCTGG - Intronic
1056165440 9:83936638-83936660 GTAGAGAGTATGGATGGGCCTGG - Intergenic
1058858899 9:109095033-109095055 GGACAGAGTATGACTGAGCAAGG - Intronic
1058961843 9:109999046-109999068 GCTCAGGGTCTGGCTGGGCACGG + Intronic
1061236831 9:129348135-129348157 TTACAATTTTTGGCTGGGCACGG + Intergenic
1061553482 9:131351176-131351198 GAACAGTGGCTGGCCGGGCATGG + Intergenic
1203623178 Un_KI270749v1:139513-139535 GGCCAGGGTATGGCAGGGCAGGG - Intergenic
1185564969 X:1088148-1088170 GTACATTTTTTGGCTGGGCCCGG - Intergenic
1185773558 X:2784290-2784312 TTAAAATGTGTGGCTGGGCATGG + Intronic
1185871211 X:3666444-3666466 GTACAGTTCACGGCTGGGCGTGG - Intronic
1185921230 X:4095589-4095611 ATACGTTGTATGGCCGGGCACGG + Intergenic
1186417345 X:9395196-9395218 TTACATTTTCTGGCTGGGCATGG - Intergenic
1186795262 X:13041461-13041483 TTAAAGTCTGTGGCTGGGCACGG - Intronic
1187339314 X:18407229-18407251 GTAAAGATTAGGGCTGGGCATGG + Intergenic
1187727962 X:22223452-22223474 TTAGAGTGAATGGCTGGGCATGG + Intronic
1188656747 X:32706798-32706820 GTAAAAACTATGGCTGGGCATGG + Intronic
1189779374 X:44499351-44499373 ATACACAGCATGGCTGGGCATGG - Intergenic
1196782636 X:119397363-119397385 GTAAAATGTATGGCCGGGCGCGG - Intergenic
1196843815 X:119882444-119882466 GTACATTGGGAGGCTGGGCACGG - Intergenic
1199006467 X:142703936-142703958 ATGCATTTTATGGCTGGGCATGG - Intergenic
1199294892 X:146145892-146145914 GTAGAATGTGTGGCTGGGCCCGG - Intergenic
1200240763 X:154492126-154492148 GTATATTATTTGGCTGGGCACGG - Intergenic
1200296221 X:154923544-154923566 GAAGAGTTTTTGGCTGGGCATGG + Intronic
1200560781 Y:4700192-4700214 GTACAGTGTATAACTGGAGATGG - Intergenic
1201191112 Y:11441877-11441899 GGCCAGGGTATGGCAGGGCAGGG - Intergenic
1201273347 Y:12276940-12276962 ATCCAATGTTTGGCTGGGCATGG - Intergenic