ID: 928571422

View in Genome Browser
Species Human (GRCh38)
Location 2:32613069-32613091
Sequence ATGTGTAAAGGCCTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 714
Summary {0: 1, 1: 0, 2: 12, 3: 85, 4: 616}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928571422 Original CRISPR ATGTGTAAAGGCCTGGAGGA GGG (reversed) Intronic
900432078 1:2607203-2607225 AGGTGTAAAGGCCCAGAGGCTGG - Intronic
900999701 1:6142658-6142680 ATGTGCAAAGGCCTGTAGTGTGG - Intronic
901673428 1:10868938-10868960 ATGTGTAGAGTCCCGCAGGACGG + Intergenic
902195590 1:14795789-14795811 ATGTGCAAAGGCCCTGAGGGAGG - Intronic
902449634 1:16488697-16488719 ATGAGCAAAGGCATGGAGGTGGG - Intergenic
902504848 1:16932645-16932667 ATGAGCAAAGGCATGGAGGTGGG + Intronic
902530603 1:17088247-17088269 ATTGGTAAAGGCATGGAGGTAGG + Intronic
902572409 1:17355194-17355216 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
902959003 1:19948735-19948757 AGGGGTAAAGGTTTGGAGGAGGG + Intergenic
903230243 1:21917665-21917687 ATGACTAAAGGCCTAGAGGCAGG - Intronic
903296036 1:22343633-22343655 ATGTGCAAAGGCCCCGAGGCAGG + Intergenic
903320545 1:22540600-22540622 CAGTGCAAAGGCCTGGAGGCAGG + Intergenic
903554579 1:24184155-24184177 GTGTGCAAAGGCCTGGAGTTGGG - Intronic
903592235 1:24465772-24465794 ATGTGTAAAGGCCTCTTGCACGG + Intronic
903765149 1:25729226-25729248 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
903818794 1:26085041-26085063 ATGTGCAAAGGCCAGGAGGTAGG - Intergenic
903946337 1:26966206-26966228 AGCTGTAAGGGCTTGGAGGAGGG - Intergenic
904008456 1:27376181-27376203 ATGTAGGAAGGCCTGGAGGCCGG + Intergenic
904273609 1:29366394-29366416 ATGTGTAAAGGCCCTGTGGTGGG + Intergenic
904318557 1:29681707-29681729 ATGAACAAAGGCCTGGAGGCAGG + Intergenic
904355921 1:29939816-29939838 ATAAGCAAAGGCCTGGAGGCAGG - Intergenic
904356277 1:29942151-29942173 ATGAGCATAGGCCTGGGGGAGGG - Intergenic
904356401 1:29942871-29942893 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
904438931 1:30517276-30517298 ATGAACAAAGGCCTGGAGGCAGG - Intergenic
904460636 1:30677665-30677687 ATGTGCAAAGGCTGGGAGGAGGG + Intergenic
904697704 1:32339464-32339486 ATATGTAAAGGCCTTGAGATGGG + Intergenic
904701126 1:32358820-32358842 GTGGGTAAAGGCCTGGAGGCAGG - Intronic
904754950 1:32763449-32763471 AAGTGGAAAGGCCTTGAGGCAGG - Intronic
904824561 1:33265939-33265961 ATGTGCAAAGGCCCCGAGGCAGG - Intronic
904944686 1:34190467-34190489 ATGTGCAAAGACCATGAGGAGGG - Intronic
905313457 1:37066287-37066309 TTGAGTAAAGACCTGGAGGAAGG - Intergenic
905319730 1:37107327-37107349 GTGGGTGAAGGCCTGGAGGTGGG + Intergenic
905347244 1:37319428-37319450 ATGTGTATATCCCTGGATGAGGG + Intergenic
905510198 1:38513313-38513335 CTGTGCAAAGGCTTGGAGGCAGG - Intergenic
905634234 1:39538712-39538734 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
906610472 1:47198433-47198455 AAGTGCAAAGGCCCTGAGGAAGG + Intergenic
907048363 1:51313663-51313685 CTGGGCAAAGGCCTGGAGGAGGG - Intronic
907238772 1:53069285-53069307 ATGTGCAAAGGCCTGGAGGGAGG + Intronic
907268662 1:53277621-53277643 TTGAGTAAAGGCTTGGAGGTGGG - Intronic
907294753 1:53443312-53443334 ATGTCTAAATCCCTGGGGGAGGG + Intergenic
907337865 1:53712175-53712197 CTGTGCAAAGGCCTGGTAGAAGG - Intronic
907657223 1:56356582-56356604 ATAAGCAAAGGCCCGGAGGACGG + Intergenic
907806483 1:57825528-57825550 AGGTGTTAAGGGCAGGAGGAAGG + Intronic
908155913 1:61352945-61352967 ATGAGCAAAGGCTTGGAGGAAGG + Intronic
908280793 1:62532781-62532803 AAGTGCAAAGGCCTGAAGGTGGG + Intronic
909175408 1:72351335-72351357 ATGAATAAAGCCCTGGAGCAAGG + Intergenic
909524772 1:76610536-76610558 AAGTATGAAGGCCTGGAGGGAGG + Intronic
909806336 1:79876983-79877005 ATGTGTAATGGCCAGTAGGTAGG - Intergenic
909853323 1:80497084-80497106 ATGTGTGATGGCCTGGAAAATGG + Intergenic
909911130 1:81259145-81259167 AAGTGTAAAGTCCTTGAGGTGGG - Intergenic
910553351 1:88501319-88501341 ATGTGTGAAGGCCTGGAGGCAGG + Intergenic
912557147 1:110524581-110524603 ATGAGTGAAGGACTGAAGGAAGG + Intergenic
913171957 1:116241197-116241219 ATGTGAAAATGCCTGGGGGCAGG + Intergenic
914935320 1:151974184-151974206 ATGTGCAAAGGACTGGAGGAGGG + Intergenic
914975758 1:152359695-152359717 CTGTGGAATGGCCTAGAGGAAGG + Intronic
916606473 1:166347448-166347470 ATGTGTCAAGGACCTGAGGATGG + Intergenic
916627264 1:166571780-166571802 ATGTGCAAAGGCCTTGAGGTAGG + Intergenic
916698439 1:167264894-167264916 AAGTGTAAAGGCCCTGAGGTGGG - Intronic
917048122 1:170886297-170886319 ATGTGTTGAGGCCAGGAAGATGG + Intergenic
917520645 1:175745697-175745719 ATGTGCAAACTCATGGAGGAGGG + Intergenic
917621798 1:176803671-176803693 ATGGGCACAGGTCTGGAGGAAGG - Intronic
918130022 1:181619343-181619365 AAGTGTGAAGGCCCTGAGGAAGG + Intronic
918617374 1:186561243-186561265 AAGGATAAAGGCATGGAGGAAGG + Intergenic
918861796 1:189837372-189837394 ATAATTAAAGGCATGGAGGATGG - Intergenic
919434100 1:197535237-197535259 ATTTTTAAATGCCTGGAGGCTGG - Intronic
919469148 1:197957411-197957433 CTGAGTAAAGACCTGGAAGAGGG + Intergenic
919491215 1:198207662-198207684 ATTTGTCAAGGATTGGAGGAGGG + Intronic
919658630 1:200221775-200221797 ATGTGCAAAGGCCCAGAGGTGGG - Intergenic
919821234 1:201473498-201473520 AGGTGCAAAGGCCCTGAGGAAGG - Intergenic
920686871 1:208116090-208116112 ATGAGCAAAGGCATGGAGGCAGG - Intronic
921581929 1:216905341-216905363 AAGTGCAAAGGCCTGGAGGTGGG - Intronic
921807690 1:219474803-219474825 ATGTGCAAGGGTCTGGAGAAAGG - Intergenic
921818513 1:219590622-219590644 AGGTGTAAAGGCCCTGAGGTAGG + Intergenic
922621825 1:226994580-226994602 ATCTGTAAAGGCCTACAGAAAGG - Intronic
923120099 1:230981859-230981881 TTGTGCAAAGGCCTTGAGGAAGG - Intronic
924476170 1:244383696-244383718 ATGTGCAAAGGCCTTGTGGCAGG + Intronic
924495373 1:244583725-244583747 ATTTCTAGAGGCCTGGAGGATGG - Intronic
924542736 1:244996398-244996420 ATGTGTGAAAGCCAGGAGGCGGG + Intronic
1062879033 10:963577-963599 ATTTGTAAACTCCTGGAAGATGG - Intergenic
1066404961 10:35109665-35109687 AAGTGAAAAAGCCTGAAGGATGG + Intergenic
1066482385 10:35809479-35809501 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1068019591 10:51564517-51564539 GTGTGTAAAGGCCCTGAGAATGG + Intronic
1068892772 10:62165044-62165066 ATGAGCAAAGGCCTGGGGGTGGG - Intergenic
1069597506 10:69681915-69681937 AGGTGAAAAGGCCTGGAGATGGG + Intergenic
1069785981 10:70988226-70988248 AAGTGCAGAGGCCTGGAGGCAGG - Intergenic
1070129415 10:73646727-73646749 ATGTGTGGAGGCCTGGGGCAGGG - Exonic
1070284822 10:75075333-75075355 ATGTGTGAAGGATTAGAGGAGGG - Intergenic
1070341787 10:75504688-75504710 ATGTGCAAAGGCCTTGTGGGAGG + Intronic
1070645306 10:78198043-78198065 ATGTGCAAAGGCCCTGAGGTAGG + Intergenic
1070774998 10:79104259-79104281 GTGAGTAAAGGCCTGGAGGCTGG + Intronic
1070780207 10:79133176-79133198 ATGTGAAAAGGCAGGGAGGTAGG - Intronic
1071338069 10:84618008-84618030 ATGTGCAAAGGCTTGAAGAAGGG - Intergenic
1073547338 10:104362025-104362047 AATTGAAAAGGCCTGGAAGATGG + Exonic
1073591325 10:104760093-104760115 AAGTGCAAAGGCCCAGAGGAGGG + Intronic
1074052913 10:109896073-109896095 ATGTGCCAAGGCCTTGAGGCAGG - Intronic
1074062038 10:109975399-109975421 ATGTGTGAAGGTCTGCAGGCAGG + Intergenic
1074216022 10:111384469-111384491 CTATGTAAAGCCCTGGGGGAGGG + Intergenic
1074300853 10:112232288-112232310 TTGTGTGAAGGGCTGGAGGTAGG + Intergenic
1074448458 10:113539500-113539522 ATGAGCAAAGGCTTGGAGGTAGG - Intergenic
1074519717 10:114208075-114208097 ATGTGTTAAGGCCTAGAGATAGG + Intronic
1076470449 10:130714550-130714572 ATCTGGAAAGGCAGGGAGGATGG + Intergenic
1076488401 10:130839361-130839383 GTGTGCAAAGGCCCTGAGGAGGG - Intergenic
1076838210 10:133031913-133031935 ATGTGGCCAGGCCGGGAGGATGG - Intergenic
1077599974 11:3567770-3567792 ATGTGCAAAGGCCTTGAGGCAGG + Intergenic
1077607506 11:3621975-3621997 ACGTGTGAAGGCCTGGGGGAGGG + Intergenic
1077794285 11:5475397-5475419 ATTTGTTAAGGCCTTGAGGTTGG - Intronic
1078087256 11:8241552-8241574 ATGTGCAAAGGCCCTGAGGCAGG - Intronic
1078477898 11:11648531-11648553 AGGTGGAGAGGCCTGGAGTAAGG + Intergenic
1078885565 11:15496516-15496538 AAGTGCAAAGGCCTTGAGGTAGG - Intergenic
1079130018 11:17741804-17741826 ATGTGCAAAGGCCCTGAGGCAGG - Intronic
1079306724 11:19329875-19329897 CTGTGCAAAGGCCTTGAGGCAGG + Intergenic
1079881078 11:25927503-25927525 ATGTGTTAAGACCTTGAGGTAGG + Intergenic
1080635626 11:34120968-34120990 ATGTGCATGGGCCTGGGGGAGGG + Intronic
1082607542 11:55260393-55260415 ATGAATAAAGGCCTGGAGTACGG - Intergenic
1082641028 11:55661852-55661874 ATGTACAAAGGCCCAGAGGAGGG - Intergenic
1082690424 11:56296042-56296064 ATGGATAAAGGCTTGGAAGACGG - Intergenic
1082962704 11:58934483-58934505 TTGTGGAATGGCCTGGAGGCTGG + Intronic
1083300565 11:61737801-61737823 GTGGGGAGAGGCCTGGAGGAGGG - Intronic
1083305949 11:61762139-61762161 ATGTGTGAAGGCCTTGATGTGGG + Intronic
1083495457 11:63048005-63048027 GTGGGCAAAGGCATGGAGGAGGG + Intergenic
1083524991 11:63354811-63354833 AAGGGTAAAGGATTGGAGGAAGG - Intronic
1083629085 11:64086567-64086589 CTGTGCAAAGGCCCGGAGGCAGG - Intronic
1083904371 11:65660487-65660509 AAGTGCAAAGGCCTTGAGGTGGG - Intronic
1084536274 11:69759094-69759116 ATGTGAAGAGGCCTCCAGGATGG - Intergenic
1084930674 11:72553300-72553322 TTGTGCAAAGGTCTGGAGGCAGG - Intergenic
1085164970 11:74390644-74390666 ATGTAAAAAGAACTGGAGGAAGG + Intronic
1085182024 11:74544017-74544039 ATGTGTCCCTGCCTGGAGGATGG + Intronic
1085345527 11:75765973-75765995 ATGGACAAAGGCCTGGAGGTAGG - Intronic
1085374954 11:76052038-76052060 TTGTGTAAAGGCCCTGTGGAAGG - Intronic
1086271929 11:85078399-85078421 AAGTGTAAAGGCTTTGAGGTAGG + Intronic
1086703078 11:89922176-89922198 ATGAATAAAGGCCTGGAGTATGG + Intergenic
1087184669 11:95176056-95176078 AAGTGTAAAGGACTTGAGGTAGG + Intronic
1087548907 11:99621282-99621304 ATGTGGAAAAGCCTGGAGTCAGG + Intronic
1087648425 11:100835135-100835157 ATATCCAAAGGCCTTGAGGATGG - Intronic
1089023492 11:115242750-115242772 ATGTGGAAAGGCCTGGTGACGGG + Intronic
1089402663 11:118173289-118173311 ACGTGCAAAGGCATGGAGAAGGG - Intronic
1089610955 11:119668514-119668536 ATGTGTAAAGGCTTGCAGTAAGG - Intronic
1089620567 11:119719977-119719999 ATGTGCAAAGGCACGGAGGCAGG + Intronic
1089749849 11:120643290-120643312 TTGAGTCAAGGCCTGGAAGAGGG + Intronic
1089868261 11:121650764-121650786 ATCTGTCAAGGGCTGCAGGAAGG - Intergenic
1089875801 11:121720677-121720699 ATATGCAAAGGCCCTGAGGAGGG - Intergenic
1091384015 12:80817-80839 CTGAGCAAAGTCCTGGAGGAGGG + Intronic
1091445098 12:540550-540572 ATTTGTAAAAGCATGGAGAAGGG + Intronic
1091778514 12:3199848-3199870 GTGTGCAAAGGCATGGAGGGGGG + Intronic
1091800476 12:3321598-3321620 CTGTGTACGGGCCTGCAGGACGG - Intergenic
1091843418 12:3636714-3636736 ATGTGGAAGGGCATGCAGGAGGG + Intronic
1091978300 12:4844526-4844548 ATGTGCAAAGGCCCTGAGGTGGG + Intronic
1092109309 12:5947632-5947654 ACTTGTAAAGGAGTGGAGGAGGG + Intergenic
1092190021 12:6512449-6512471 ATATGCAAAGACCTTGAGGAGGG + Intronic
1093186924 12:16030523-16030545 AAGTGTAAAGGCCTTGAGCTAGG - Intronic
1093756505 12:22858973-22858995 ATGTGTAAAGCCCTGTGGCAGGG + Intergenic
1094133805 12:27102607-27102629 AAGTGCAAAGGCCCCGAGGAGGG - Intergenic
1094155998 12:27337494-27337516 CTGAGGAAAGGCCTGGAGGTGGG - Intronic
1095053587 12:37575858-37575880 AGGTGTAAAGGTCTGAAGCATGG - Intergenic
1095989981 12:48027829-48027851 CTGTGTAAACTCCTGGAGGCAGG + Intergenic
1097357314 12:58616182-58616204 ATCTGTTAAGTCCTGGAGGCTGG + Intronic
1097736095 12:63182744-63182766 ATGTGCAAATGAATGGAGGAGGG + Intergenic
1098051519 12:66458824-66458846 AAGTGCAAAGGCCTTGAGGCAGG - Intronic
1098134900 12:67391842-67391864 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1098229283 12:68356457-68356479 ATCTGGAACTGCCTGGAGGATGG + Intergenic
1100357809 12:93848618-93848640 ATGTGCAAAGGCCCAGAGGCAGG - Intronic
1100381937 12:94070600-94070622 TTGAGCAAAGGCCTGGAGGAGGG + Intergenic
1101708649 12:107244387-107244409 AAATGTAAAGGCCAGGAGGCAGG + Intergenic
1101929951 12:109005812-109005834 TAGTGCAAAGGCCTGGAGGTGGG + Intronic
1102240353 12:111320996-111321018 ATCTGGAGGGGCCTGGAGGAGGG - Intronic
1102372309 12:112392368-112392390 AAGTGCAAAGGCCTAGAGGTAGG - Intergenic
1102396292 12:112589048-112589070 ATATGCAAAGGCCTTGAGGCAGG + Intronic
1102452592 12:113052993-113053015 ATGTGCAAAGGCCCAGAGGTGGG - Intergenic
1102461559 12:113102891-113102913 ATGAGCAAAGGCCTAGAGGTTGG - Intronic
1102528307 12:113527748-113527770 ATGTGCAAAGGCCCTGAGGTAGG - Intergenic
1102622632 12:114208839-114208861 AAGTTCAAAGGCCTGGAGGTGGG + Intergenic
1102636787 12:114331567-114331589 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1102714326 12:114956858-114956880 GTGTTTAAAGGCTTGGAGGCAGG + Intergenic
1102814933 12:115858127-115858149 ATGTCCTAAGGCCTGGAGGCAGG - Intergenic
1102822245 12:115917646-115917668 CTGTGCAAAGGCCTGGAGATAGG + Intergenic
1102826040 12:115948623-115948645 ATGTGCAAAGGCCGAGAGGTGGG + Intergenic
1102929033 12:116848631-116848653 ATGTGCAAAGGCCCTGAGGCTGG - Intronic
1103042942 12:117710889-117710911 ATGTGCAAAGGTCTTGAGGCAGG - Intronic
1103042995 12:117711359-117711381 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1103043532 12:117715922-117715944 ATGTGCAAAGGCCCTGAGGCAGG - Intronic
1103101063 12:118176250-118176272 ATGTGGAAAGACCTTGGGGAAGG + Intronic
1103177134 12:118874049-118874071 AAGTGCAAAGGCCCGGAGGCAGG - Intergenic
1103197394 12:119056638-119056660 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1103238006 12:119390168-119390190 TTGTGCAAATGCCTGGAGGTGGG - Intronic
1103361034 12:120353777-120353799 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1103993756 12:124816032-124816054 ATGTGCAAAGGTCTGAAGGCTGG - Intronic
1104051333 12:125195817-125195839 AGGTGTAAAGGCCCTGAGGTGGG + Intronic
1104078882 12:125413030-125413052 CTGTGTAAAGACCTACAGGAAGG + Intronic
1104386508 12:128355741-128355763 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1104475333 12:129066419-129066441 ATGGGCAAAGGCCTTGAGGTGGG + Intergenic
1104721524 12:131047274-131047296 TTGTGTGCTGGCCTGGAGGAGGG + Intronic
1104738861 12:131157963-131157985 ATGTGCAAAGGCCCCGAGGCAGG - Intergenic
1106345363 13:28871884-28871906 AAGTGCAAAGGCCCGGTGGAGGG + Intronic
1107797144 13:44064529-44064551 ATGTGTAGAGGCCTGGAGGCAGG + Intergenic
1109864507 13:68245265-68245287 AAGTATAAAGGTCTTGAGGATGG - Intergenic
1111262688 13:85762263-85762285 ATGTGTAAAGCCTTTGAGGCTGG - Intergenic
1111872217 13:93847168-93847190 AAGTGTAATGGCCATGAGGAAGG + Intronic
1112221342 13:97494373-97494395 ATGTGCAAAGGCCTTGAGATGGG + Intergenic
1112312340 13:98330118-98330140 CTGTGCAAAGGCCTGGAGGTGGG + Intronic
1112716491 13:102192038-102192060 CTGTGTAAAAGCCTGGAGGCAGG - Intronic
1114050447 14:18916515-18916537 GTGTGTAAAGGACTAGGGGAGGG + Intergenic
1114112110 14:19485417-19485439 GTGTGTAAAGGACTAGGGGAGGG - Intergenic
1114297134 14:21340120-21340142 AAGTGTAAAGGCCCTGAGGTAGG + Intronic
1114621313 14:24098046-24098068 ATGGGACAAAGCCTGGAGGAAGG + Intronic
1114703915 14:24706670-24706692 ATATGGAGAGGCCTGGGGGAAGG + Intergenic
1114731486 14:24997291-24997313 GAGAGTAAAGGCCTGGATGATGG - Intronic
1114734830 14:25033572-25033594 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1115364504 14:32542653-32542675 ATGTGCCAAGGCCTTGAGGAAGG + Intronic
1115794400 14:36917237-36917259 AGGGGTGAAGGCCTGGATGAGGG - Intronic
1116960756 14:50965819-50965841 AGGGGTAAAGGCCTTGAGGCGGG - Intergenic
1117314156 14:54557636-54557658 CAGTGGAAAGGCCTGGAGAAGGG + Intergenic
1119395922 14:74326449-74326471 ATGTTCACAGCCCTGGAGGATGG + Intronic
1119405640 14:74397124-74397146 AAGTGTGAAGGGCTGAAGGAAGG + Intergenic
1119459838 14:74791498-74791520 ATGTGTAAAAGCCAGAAGAAAGG - Intronic
1119889707 14:78173629-78173651 AGATGGAAAGGGCTGGAGGAAGG - Intergenic
1120452093 14:84681215-84681237 ATGTATAAAGGACAGAAGGAAGG + Intergenic
1120605678 14:86574208-86574230 ATATTTAAAGGGCTGGAGCATGG + Intergenic
1120715783 14:87839435-87839457 AAGTGTAAATACTTGGAGGATGG - Intronic
1120823635 14:88935542-88935564 AAGTGCAAAGGCCTTGAGGTAGG - Intergenic
1121276459 14:92671338-92671360 GTGTGCAAAGGCCTGGAGAGGGG + Intronic
1121701583 14:95958675-95958697 ATGTAAAAAGGCTTGGGGGAAGG - Intergenic
1122184800 14:99983528-99983550 ATGGGAAAAGGACTGGAGAAGGG - Intronic
1122234748 14:100325293-100325315 CTGGGCAAAGGCCAGGAGGAGGG - Intronic
1123428547 15:20193743-20193765 ATGTTTATAGGGATGGAGGAAGG + Intergenic
1124351146 15:28956371-28956393 ATGAGGAAAGGCGTGGAGGCTGG + Intronic
1124369954 15:29098937-29098959 GTATGTGAGGGCCTGGAGGATGG - Intronic
1124374515 15:29121820-29121842 AGGGATAAAGGACTGGAGGAAGG + Exonic
1124492307 15:30165533-30165555 ATGTGCAAAGGCCCCGAGGAGGG - Intergenic
1124651588 15:31478033-31478055 ATGTGCAAAGGCCCTGAGGCAGG + Exonic
1124751228 15:32372784-32372806 ATGTGCAAAGGCCCCGAGGAGGG + Intergenic
1125087524 15:35747894-35747916 ATGTGCAAATGCCTTGAGGCTGG - Intergenic
1126194565 15:45917769-45917791 AGGTGTAAAGCACAGGAGGAAGG - Intergenic
1128095060 15:64947741-64947763 CTGTGCAGAGGCCTGGAGGAGGG - Intronic
1128214892 15:65927691-65927713 ATGTGCAAAGGCCTGGAGTCAGG + Intronic
1128255848 15:66196036-66196058 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1129028477 15:72601481-72601503 TTGTGCAAAGGCCCTGAGGATGG - Exonic
1129047397 15:72748488-72748510 TTGGGTAAAGGCCTATAGGAGGG - Intergenic
1129339434 15:74875348-74875370 ATGTGTAAAGGCCCTGAGACAGG - Intergenic
1129711278 15:77821354-77821376 ATGTGCAAAGACCTGGAAGTGGG + Intergenic
1129774690 15:78228799-78228821 ATGTGCAAAGGCCCCGAGGTGGG - Intronic
1129868753 15:78927875-78927897 ATGTGCCAGGGCCTGGGGGATGG + Intronic
1129991181 15:79964907-79964929 AAGTGCAAAGGCCTTGAGGGTGG + Intronic
1129998047 15:80023752-80023774 ATGTGCAAAGGCCCTGAGGCAGG - Intergenic
1130011349 15:80155028-80155050 ATGTGCTAAGGCCTGAAGGCAGG - Intronic
1130054388 15:80509774-80509796 AAGTGCAAAGGCCTGGAGGCAGG + Intronic
1130059285 15:80558054-80558076 ATGTGCAAAGGCCCTGAGGTTGG - Intronic
1130334374 15:82946473-82946495 AGGTGTAAAGGCCCTGAGGCAGG - Intronic
1130626759 15:85523424-85523446 CTGAGTAAGGGCCTGAAGGAAGG - Intronic
1130674316 15:85938742-85938764 CTCTGTAAAGACCTGGAGGTCGG - Intergenic
1131439275 15:92446802-92446824 AAGTGCAAAGGCCTTGAGGTAGG + Intronic
1131931931 15:97452298-97452320 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1133398051 16:5464199-5464221 ATGTGGAGAGGCCAAGAGGATGG + Intergenic
1133579036 16:7125169-7125191 AAGTGTAAGGGCTTGGGGGACGG + Intronic
1133774701 16:8887484-8887506 GTGGCTGAAGGCCTGGAGGAGGG + Intergenic
1133830673 16:9320589-9320611 ATGTACAAAGGCCTTGAGGCAGG - Intergenic
1133898702 16:9953047-9953069 ATGAGGAAGGGCTTGGAGGAGGG + Intronic
1133928961 16:10216682-10216704 ATGTGCAAAGGCCCTGAGGAGGG + Intergenic
1134505814 16:14806011-14806033 ATGTGCAAAGGCCCAGAGGTGGG - Intronic
1134513513 16:14868008-14868030 ATGTGCAAAGGCCCCGAGGAGGG - Intronic
1134574766 16:15322928-15322950 ATGTGCAAAGGCCCAGAGGTGGG + Intergenic
1134678886 16:16110037-16110059 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1134701150 16:16266503-16266525 ATGTGCAAAGGCCCCGAGGAGGG - Intronic
1134749856 16:16617387-16617409 ACCTGCAAAGGCCCGGAGGAAGG + Intergenic
1134939758 16:18278289-18278311 ATGTGCAAAGGCCCAGAGGTGGG + Intergenic
1134970678 16:18528143-18528165 ATGTGCAAAGGCCCCGAGGAGGG + Intronic
1134995617 16:18736228-18736250 ACCTGCAAAGGCCCGGAGGAAGG - Intergenic
1135598231 16:23759791-23759813 ATGTGCAAAGCCCTGGAGCAAGG - Intergenic
1135627993 16:24012873-24012895 ATGTGCAAATGCCTGGTGGCAGG - Intronic
1135698784 16:24613274-24613296 GTGTGTGAAGGCCTTGAGGAGGG + Intergenic
1135889581 16:26345165-26345187 TTGCGTAAAGGCCTGGAGACTGG + Intergenic
1136110174 16:28059628-28059650 CTGAGGAGAGGCCTGGAGGAGGG - Intronic
1137526245 16:49239009-49239031 TTGTGCAAAGGCCAGGGGGAGGG - Intergenic
1137797709 16:51236208-51236230 AAGTGCAAAGGCCTGGAGGCAGG - Intergenic
1138395799 16:56703775-56703797 AGGTGCAAAGGCCTTGAGGCAGG - Intronic
1138457885 16:57131797-57131819 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1138532653 16:57643225-57643247 GTGTGCAAAGGCTTGGAGGTGGG + Intronic
1139234380 16:65319069-65319091 CTGAATAAAGGCCTGGAGGCAGG + Intergenic
1139293239 16:65876737-65876759 ATGTGCAAAGGCTCAGAGGAGGG + Intergenic
1139449144 16:67016325-67016347 AGGAGCAAAGGCCTGGAGGCAGG + Intergenic
1140404703 16:74700921-74700943 GTGTGGAAAGGACAGGAGGAAGG - Intronic
1140956414 16:79870553-79870575 ATGTGCAAAGGCGGGGAGCATGG + Intergenic
1140984987 16:80149862-80149884 ATGTGGAAAAGTCTGCAGGATGG + Intergenic
1141610456 16:85178298-85178320 AAGTGTTAAGGCCTGGATGTTGG + Intronic
1141624432 16:85253825-85253847 GTGTGCAAAGGCCAGGAGGTGGG + Intergenic
1143000995 17:3794962-3794984 CTGTGTCGAGGCCTGGAGGCAGG - Intronic
1143193105 17:5055017-5055039 ATATGCAAAGGCCCTGAGGAAGG + Intergenic
1143374679 17:6460230-6460252 ATGTGCAAAGGCACGGAGGCAGG - Intronic
1143382930 17:6507733-6507755 ATGTGTCAGGCCCTGGAGGAGGG + Intronic
1143816270 17:9518304-9518326 GTCTGGTAAGGCCTGGAGGAGGG - Intronic
1144414456 17:15033176-15033198 AGGTGTAAGGGCATGGAAGAAGG + Intergenic
1144742647 17:17592513-17592535 ATGTACAAAGGCCTGGAGACAGG + Intergenic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1145064233 17:19751158-19751180 ATGTGCAAAGGCCTTGTGGTAGG - Intergenic
1145102779 17:20090452-20090474 ATGTGCAAAGGCCCGGAGCCAGG + Intronic
1145239579 17:21232545-21232567 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1145262012 17:21360118-21360140 ATAGGCAAAGGCCTGGAGGCAGG - Intergenic
1145266399 17:21381533-21381555 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1145374119 17:22331879-22331901 AGGTGTAAAGGTCTGAAGCATGG - Intergenic
1145764936 17:27452089-27452111 ATGTGCAAAGGCCCTGAGGTAGG - Intergenic
1146153935 17:30503641-30503663 ATGAGTAAAGACCTGGAGACTGG + Intronic
1146679026 17:34793685-34793707 CTGGGCAAAGGCATGGAGGATGG - Intergenic
1146935862 17:36812430-36812452 CAGTGCAAAGGCCTGGAGGAGGG - Intergenic
1147395857 17:40142230-40142252 ATCTGTTAAGCCCTTGAGGATGG + Intronic
1148194891 17:45706231-45706253 ATGTGCAAAGGCCCTGAGGCAGG - Intergenic
1148602253 17:48903262-48903284 ATGGGCAAAGGCTTGGAGGGGGG + Intergenic
1148698193 17:49573634-49573656 ATGACTAAAGGTCTGGAGGCTGG - Intergenic
1149287859 17:55185876-55185898 ATGTTTAAAGGCACGGAGAAAGG + Intergenic
1149681454 17:58510352-58510374 AAGTGCAAAGGCCTTGAGGTGGG - Intronic
1149792967 17:59495213-59495235 AAGTGTAAAGGCTTGGAGGTGGG - Intergenic
1150908206 17:69361254-69361276 AAGTGCAAAGGCCCTGAGGAGGG + Intergenic
1152263805 17:79281729-79281751 GTGTGAAAAGCCCTTGAGGAAGG - Intronic
1152861874 17:82701086-82701108 ATGTGTAAAGTCCAGGCAGAGGG + Intergenic
1153603773 18:6810231-6810253 ATGTATAAAGGAATGAAGGATGG + Intronic
1154284497 18:13039533-13039555 CTGTGTGCAGGCCTGGAGGTAGG + Intronic
1156498505 18:37541732-37541754 AGGTGCAAAGGCCCGGAGGCAGG - Intronic
1156767878 18:40680642-40680664 TTGTGTAAAGGTCTAGATGAAGG + Intergenic
1158242982 18:55398448-55398470 ATCTGGAAAGGCCTGAATGAGGG - Intronic
1158261378 18:55609744-55609766 AAGTGCAAAGGCCCTGAGGAAGG - Intronic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1160058107 18:75505268-75505290 ATGTGTAAATACCTAAAGGAGGG + Intergenic
1160746808 19:715555-715577 ATGTGCAAAGGGCTAGAGGTGGG + Intronic
1160916824 19:1500741-1500763 CTGTGCAAAGGCCTTGAGGCAGG + Intergenic
1161273379 19:3402793-3402815 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1161521246 19:4724529-4724551 ATGTCTAAAAGGCAGGAGGAAGG + Intronic
1161622116 19:5303532-5303554 ACGTGTAAAGGCCCCGAGGTGGG + Intronic
1161930094 19:7333650-7333672 ATGTGCAAAGTCCCGGAGGCTGG + Intergenic
1161963029 19:7533404-7533426 AAGTGCAAAGGCCCGGAGGTGGG + Intronic
1162146401 19:8614739-8614761 AAGTGCAAAGGCCTTGAGGCAGG - Intergenic
1162152903 19:8658095-8658117 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1162362663 19:10229232-10229254 AGGGGTAAAGGCTTGGAGGTAGG - Intronic
1162441702 19:10696281-10696303 AAGAGCAAAGGCCTGGAGGTGGG - Intergenic
1162574572 19:11491548-11491570 AGGTGCAAAGGCCTTGAGGCAGG - Intronic
1162752488 19:12837474-12837496 AAGGGCAAAGGCCTGGAGGCGGG - Intronic
1162822756 19:13233175-13233197 CTGTGTAAAGGCCCTGAGGCAGG - Intronic
1162856501 19:13472574-13472596 ATGTGCAAAGGCCCTGGGGAAGG - Intronic
1163484105 19:17576406-17576428 ATGTGCAAAGGCCCTGAGGTAGG + Intronic
1163550775 19:17965518-17965540 AAGTGCAAAGGCCTGGAGGTGGG + Intronic
1163581913 19:18144345-18144367 ATGAGCAAAGGCCAGGAGGCTGG + Intronic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1163674775 19:18650088-18650110 GCTTGTAAAGGCCTGGAGGGGGG + Intronic
1164632126 19:29768774-29768796 ATGTGGAAAGGCCTGGAGTCAGG + Intergenic
1164678106 19:30115871-30115893 ATGTGCAAAGGCCTTGAAGTGGG + Intergenic
1164776358 19:30856658-30856680 AGGGGTATAGGCCTGGAGAATGG - Intergenic
1164892788 19:31839395-31839417 ATGTGCAAAGGCCCTGAGGCTGG + Intergenic
1165221044 19:34317055-34317077 ATGGCTGAAGGCCTGAAGGAGGG - Intronic
1165697819 19:37914276-37914298 AAGTGTTAAGGCCCGGAGGTGGG + Intronic
1165784636 19:38453736-38453758 ATGTGCAAAGGCCATGAGGTGGG + Intronic
1165791959 19:38498015-38498037 TTGTGTAAAGCTCTGAAGGAAGG + Intronic
1165854797 19:38873135-38873157 TTCTGCAGAGGCCTGGAGGATGG + Intronic
1166006912 19:39914382-39914404 AAGTGCAAAGGCCTCGAGGTGGG - Intronic
1166335367 19:42103059-42103081 ATGTATAAAGGCCCTGAGGCAGG - Intronic
1166650501 19:44570756-44570778 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1167170409 19:47827370-47827392 AGGTGCAAAGGCTTGGAGGCTGG - Intronic
1167455658 19:49595793-49595815 ATGTGGCCAGGCCAGGAGGAGGG - Exonic
1167488303 19:49776269-49776291 AGGTGCAATGGCCTGGAGGTAGG - Intronic
1167690223 19:50980538-50980560 GTGTGCAAAGACCTGGGGGACGG + Intronic
1168335717 19:55596502-55596524 AAGTGCAAAGGCCCTGAGGAAGG - Intronic
925984009 2:9200575-9200597 ATGTGCACAGGCAGGGAGGAAGG + Intergenic
926783174 2:16494403-16494425 AAGTGCAAAGGCCTTGAGGTGGG - Intergenic
927010508 2:18898967-18898989 ATGTGGAAAGGCCTTAAGGCAGG + Intergenic
927068086 2:19493830-19493852 ATGTTTAAAGAACTGAAGGAAGG + Intergenic
927247632 2:20970342-20970364 AAGTGCAAAGGCCTGGAGACAGG - Intergenic
927512614 2:23653786-23653808 ATTTGTAGAGACCTGGAGGGTGG - Intronic
927631798 2:24780926-24780948 AGGTGCAAAGGCCTTGAGGCTGG + Intergenic
927728271 2:25445668-25445690 ATATGTAAAGGCCCTGAGGCTGG - Intronic
928259777 2:29756134-29756156 ATGTGCAAAGGCCTGGAGGCGGG - Intronic
928571422 2:32613069-32613091 ATGTGTAAAGGCCTGGAGGAGGG - Intronic
928975245 2:37080079-37080101 AAGTATAAAGGCCTTGAGGTTGG + Intronic
929952836 2:46429280-46429302 GTGAGCAAAGTCCTGGAGGAGGG + Intronic
929988934 2:46767903-46767925 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
932056941 2:68455226-68455248 ATGTGGAAATGACTGGAGTATGG - Intergenic
932089334 2:68790991-68791013 AAGTGCAAGGGCCTGGAGGCAGG - Intronic
932327791 2:70874716-70874738 ACGTTTAAAGGGCTGGAGGTTGG + Intergenic
932338551 2:70944588-70944610 AGGTCTGAAGGGCTGGAGGATGG - Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932772647 2:74509405-74509427 ATGAGTAAAGACCTGAAAGAAGG - Intergenic
934527330 2:95059864-95059886 AGGTGTAGCGCCCTGGAGGAGGG - Intergenic
936175335 2:110214800-110214822 ATGTGGAAGTTCCTGGAGGATGG - Intergenic
936637241 2:114272782-114272804 AAGTGCAAAGGCCCTGAGGAAGG + Intergenic
936693414 2:114919901-114919923 ATATGAAAAGGCCAGGTGGAGGG - Intronic
937327709 2:121001530-121001552 ATCTGTAAAGGCCCTGAGGGAGG + Intergenic
937369496 2:121287426-121287448 TCCTGCAAAGGCCTGGAGGAAGG + Intergenic
937499404 2:122462009-122462031 ATGTGTAAAAACCTTGAGGTAGG + Intergenic
937696506 2:124814197-124814219 ATGTGCAAAGACCTAGAGGAAGG - Intronic
938569697 2:132551406-132551428 ATGTGTCAAGCCCTGGGGGAAGG - Intronic
938761592 2:134431073-134431095 AGATGTGAAGGCCTGGAGGGGGG + Intronic
939242638 2:139581330-139581352 AAGTGCAAAGGCCTAGAGGCTGG - Intergenic
939358364 2:141134249-141134271 AGGAGCAAAGGCCTGAAGGAGGG - Intronic
939609598 2:144294275-144294297 ATGTGCAAAGGCCTTGTGGCAGG - Intronic
940290946 2:152077085-152077107 AAGTGCTAAGGCCTGGAGGCAGG + Intronic
940949401 2:159655352-159655374 ATATTTAAAGTCCTGGAGGTGGG - Intergenic
941420212 2:165275143-165275165 ATTTGAAAAGGCCTGTTGGAAGG - Intronic
942421121 2:175809020-175809042 ATGTGCAAAGGCCCTGTGGAAGG + Intergenic
942950288 2:181713527-181713549 AGGTGCAAAGGCCTTGAGGCAGG + Intergenic
944066075 2:195620222-195620244 ATGTCTAAAGTCCTGGAGGCAGG - Intronic
944199849 2:197094991-197095013 ATGTGCAAAGGCCTGGGGGCAGG - Intronic
945143761 2:206715065-206715087 CTGGGCAAAGGCATGGAGGATGG + Intronic
945148453 2:206763332-206763354 ATGTCTAATTGACTGGAGGAGGG - Intronic
946141000 2:217690557-217690579 ATGTGCAAAGGCCTGGAGGTGGG - Intronic
946181335 2:217950875-217950897 ATGAGCAGAGCCCTGGAGGATGG - Intronic
946408088 2:219502815-219502837 AGGTATAAAGGCCTGGAGGCAGG + Intronic
947445260 2:230158098-230158120 TGGTGTAAAGGCCTTGAGGCAGG + Intergenic
947566921 2:231200184-231200206 ATGCGCAAAGGCCTTGAGGTTGG + Intronic
948589400 2:239039520-239039542 CTGTGCAAAGGCCTGGAGGCAGG + Intergenic
1168837766 20:889049-889071 ATGTGCAAAGGCCCGGAGGGAGG - Intronic
1168978249 20:1983908-1983930 ATGTGCAAAGGCCTGGGGGTGGG - Intronic
1168978649 20:1986812-1986834 TTGTGCAAAGGCTTGGAGGGTGG - Intronic
1169051907 20:2586093-2586115 ATTTTTAGAGGCCTTGAGGAGGG - Intronic
1170079857 20:12462529-12462551 AGGTGTAAAGGCCCTGAGGTGGG + Intergenic
1170195648 20:13686756-13686778 ATGTGTAAAGGCTGTGAAGAGGG - Intergenic
1170379706 20:15743635-15743657 ATGTGTAGAGGCCTGGAGGGAGG - Intronic
1170580335 20:17694396-17694418 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1170642747 20:18170007-18170029 TTCTGTAAAGGCTTGGAGAAGGG + Intronic
1171139678 20:22729919-22729941 GTGTGGAAAGTCATGGAGGAGGG + Intergenic
1171349247 20:24490379-24490401 ATGAGGAGAGGCCTAGAGGAGGG + Intronic
1171528679 20:25836539-25836561 AGGTGTAAAGGTCTGAAGCATGG + Intronic
1171548147 20:26019347-26019369 AGGTGTAAAGGTCTGAAGCATGG - Intergenic
1172129841 20:32648237-32648259 GAGTGCAAAGGCCTGGAGGCAGG - Intergenic
1172197124 20:33099607-33099629 ATGGGCAAAGGCCAGGAGGCAGG - Intronic
1172288522 20:33758322-33758344 AGGTGCAAAGGCCCGGAGGCAGG + Intronic
1172473019 20:35214872-35214894 GGAGGTAAAGGCCTGGAGGAAGG - Intergenic
1172483569 20:35285623-35285645 ATGGGGAAACCCCTGGAGGAGGG - Intergenic
1172592027 20:36124506-36124528 ATGTGTAAAGGTCTTGAGACTGG - Intronic
1172633476 20:36394040-36394062 ATGTGCAAAGGCCTTGAGGCTGG - Intronic
1172847009 20:37935522-37935544 CTGTGCAAAGGCCTGGAGGTGGG - Intronic
1172874637 20:38156734-38156756 AAGTGTAAAAGGCTGTAGGAAGG - Intronic
1173234408 20:41231387-41231409 ATGTGTGAAGGCAAGGAGGCTGG - Intronic
1173494940 20:43511836-43511858 TTGAGTTAAGGCCTGGAGGATGG + Intronic
1173580425 20:44143115-44143137 ATGTGCAAAGGACTGCAGGCAGG + Intronic
1173610256 20:44361981-44362003 ATATGAAAAGGCCTGGAGCCTGG + Intronic
1173968136 20:47129461-47129483 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1174061404 20:47835552-47835574 ATGTGCAAAGGCCTGGGGGGAGG - Intergenic
1174070122 20:47893771-47893793 ATGTGCAAAGGCCTGGGGGGAGG + Intergenic
1174079511 20:47960956-47960978 AGGTGCCAAGGCCTGGAGGTAGG - Intergenic
1174138164 20:48394757-48394779 AGGTGCCAAGGCCTGGAGGCAGG + Intergenic
1174156271 20:48517454-48517476 ATGTGCAAAGGCCTGGGGGGAGG - Intergenic
1174186950 20:48712780-48712802 AAGTCCAAAGGCCTGGAGGCAGG - Intronic
1174200668 20:48804484-48804506 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1174205542 20:48835604-48835626 AGGTGCAAAGGCTTGGAGGTAGG + Intergenic
1174317625 20:49714586-49714608 AGGTGTAAAGGCCCTGAGGTAGG + Intergenic
1174424523 20:50422709-50422731 TTGTGCAAAGGGCTGGAGGCAGG + Intergenic
1174441873 20:50562155-50562177 ATGTCTAAAGACCTGGAAGGGGG - Intronic
1174577487 20:51546905-51546927 ATGTGTAAAGGCTCTGAGGCAGG + Intronic
1175110829 20:56646776-56646798 ATGTGCAAAGGCCCTGAGGTGGG + Intergenic
1175113843 20:56667840-56667862 AAGTGCAAAGGCCTGGAGATGGG + Intergenic
1175222485 20:57425434-57425456 CTGTGCAAATGCCTGGAGGTTGG + Intergenic
1175261502 20:57677053-57677075 ATGTGCAAAGGCCTTGGGGTGGG - Intronic
1175355801 20:58366524-58366546 ATGTGTAATGGACTGAATGAGGG - Exonic
1176217176 20:63953726-63953748 ATGTGTGGAGACCTGGAGGCAGG + Intronic
1176956887 21:15115856-15115878 ATATTTAAAAGCCTGGGGGAAGG - Intergenic
1177524853 21:22277890-22277912 ATTTGGAAAGGTCTGGAGAATGG + Intergenic
1177642554 21:23862259-23862281 ATGTGTAAAAGCTTACAGGAAGG + Intergenic
1178076514 21:29017839-29017861 ATATTCAAAGGCCTTGAGGAAGG + Intronic
1179405314 21:41121115-41121137 CTGTGTGAAGACCTGAAGGAGGG - Intergenic
1179509775 21:41864933-41864955 ATGTGGAAAGGCCCAGAGGCAGG - Intronic
1180468923 22:15638889-15638911 GTGTGTAAAGGACTAGGGGAGGG + Intergenic
1180870841 22:19146421-19146443 ATGTGCAAAGGCCTAGTGGTGGG + Intergenic
1181046218 22:20215566-20215588 ATTAGCAAAGGCCTGGAGGCTGG - Intergenic
1181181240 22:21069969-21069991 ATGGGGGAAGGCATGGAGGAGGG + Intergenic
1181911685 22:26243468-26243490 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1181960086 22:26616540-26616562 ATGGTCAAAAGCCTGGAGGAAGG - Intronic
1181998990 22:26904659-26904681 ATGTGCAAAGGCCTGGTGGCCGG + Intergenic
1182060156 22:27391553-27391575 GAGTGCAAAGGCCTGGAGGTGGG + Intergenic
1182105513 22:27686264-27686286 ATGTGCAAAGGCCAGGAGGTGGG + Intergenic
1182111612 22:27727517-27727539 AAGTGCAAAGGCCTAGAGGTAGG - Intergenic
1182459633 22:30474579-30474601 ATGGGCAAAGGCATGGAGGTGGG + Intergenic
1182780411 22:32863120-32863142 ATGTGTCCAGGCCTGGAGCTGGG - Intronic
1183322420 22:37173115-37173137 ATGGGTCAAGGCCAGGAGGTAGG - Intronic
1183384105 22:37505117-37505139 ATGTGCAAAGGCCCTGAGGCAGG + Intronic
1184352536 22:43954097-43954119 GTGTGTGAGGCCCTGGAGGATGG - Intronic
1184419143 22:44369459-44369481 AAGGGCAAAGGCCTGGAGGCAGG - Intergenic
1184423845 22:44397503-44397525 AGGTGCCAAGGCCTGGAGGTGGG - Intergenic
1184592433 22:45494045-45494067 CTGTGTACAGGTCTAGAGGAAGG - Intergenic
1185216996 22:49606864-49606886 ATGTGTAAAGACGTGAAGGGTGG + Intronic
1185307570 22:50129063-50129085 ACGTGTATAGGCCTTGTGGATGG + Intronic
1185360781 22:50405438-50405460 AAGTGTGAAGGCCTGGAGAGAGG + Intronic
1185360860 22:50405830-50405852 GAGTGTGAAGGCCTGGAGGGAGG + Intronic
1185360910 22:50406083-50406105 GAGTGTGAAGGCCTGGAGGGAGG + Intronic
949779425 3:7669376-7669398 ATGTGCAAAGGGCTTAAGGATGG + Intronic
949838981 3:8300024-8300046 ATGTGTTAGGGCTGGGAGGAGGG - Intergenic
950016925 3:9760963-9760985 AAGTGCAAAGGCCCTGAGGAGGG - Intronic
950024649 3:9811806-9811828 ATGTGCAAAGGCCTTGAGGCTGG - Intronic
950076242 3:10189296-10189318 ATGTACAAAGGCCTGGGGGTGGG + Intronic
950158338 3:10740599-10740621 CAGTGCAAAGGCCTGGAGAAGGG - Intergenic
950181869 3:10919040-10919062 ATGTGCAAAGGCCCTGAGGGAGG - Intronic
950457740 3:13102695-13102717 ACATGCAAAGGCCTGGAGGGTGG - Intergenic
950480049 3:13238431-13238453 CTGAGTAGAGGCCTGGAGGAAGG - Intergenic
950899327 3:16482998-16483020 ATGTCAGAAGCCCTGGAGGAGGG - Intronic
951040522 3:17984036-17984058 ATGGGTAAAGACCTGGAGATAGG - Intronic
952731245 3:36638756-36638778 ATGTGTAATACCCTAGAGGAAGG + Intergenic
952961039 3:38589217-38589239 AAGTGCAAAGGCCCCGAGGAGGG - Intronic
953209878 3:40866443-40866465 ATGAGCAGAGGCCTGGAGCACGG + Intergenic
953263010 3:41358522-41358544 GTGAGTAAAGACCTGAAGGAAGG + Intronic
953691145 3:45120763-45120785 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
953817429 3:46170701-46170723 ATGTGGAATGGCCTGCAGGGTGG + Intronic
954443065 3:50532206-50532228 GAGTGCAAAGGCCTGGAGGCAGG + Intergenic
954652680 3:52174988-52175010 CTGTGCAAAGGCCCTGAGGAGGG - Intergenic
954687263 3:52377663-52377685 AAGGGCAAAGGCCTGGAGGTGGG - Intronic
955614078 3:60787275-60787297 ATGTGTAAAAAGCTGGAGCAGGG - Intronic
955940172 3:64139798-64139820 ATGTGTAAAGGCCCTGTGGTAGG - Intronic
956750747 3:72342120-72342142 CTGTGCAGAGGCCTGGAGGCAGG + Intergenic
956752115 3:72351720-72351742 ATGTGCAAAGGCCCAGAGGCAGG - Intergenic
957631914 3:82727085-82727107 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
959860110 3:111206969-111206991 ATGTGTAACTGCCTGAAGCAAGG - Intronic
960334294 3:116397308-116397330 AAGTGAAAAGGCCTTGAGGCAGG - Intronic
960867580 3:122217584-122217606 ATGTGCAAAGGCCTTGAGGCTGG + Intronic
961740470 3:129030403-129030425 ATGTCTAAAGGCAGGAAGGAAGG + Intronic
961863658 3:129937996-129938018 TTGAGCAAAGGCCTGAAGGAGGG - Intergenic
962408900 3:135124158-135124180 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
963004670 3:140715333-140715355 ATGTGGAAAAGGCTGGTGGACGG - Intergenic
963730144 3:148963350-148963372 AGGTGCAAAGGCCTTGAGTAGGG + Intergenic
963753270 3:149204725-149204747 ATGAGTAAAGACTTGGAGCAGGG + Intronic
964499659 3:157334822-157334844 TTGGGTAAAGGCATGGAGGTGGG + Intronic
964697401 3:159525006-159525028 ACATGCAAAGGCCTGGAGGTGGG - Intronic
964830410 3:160878126-160878148 ATGTGTGATGGCCTGCAGGGTGG - Intronic
965690103 3:171346736-171346758 ATGTGCAAAGGTCTTGAGGCAGG + Intronic
966143334 3:176782067-176782089 AAGTGTAAAGGCCTTGAAGGGGG + Intergenic
966212665 3:177469329-177469351 TTGTGCAAAGGCCTGGGGGTGGG + Intergenic
966752798 3:183338643-183338665 ATGTGTGAAGGCATAGAGGCAGG - Intronic
966834750 3:184040554-184040576 TTGTGGACATGCCTGGAGGACGG - Intergenic
967134015 3:186497753-186497775 ATGGGTATTGGCCTGGAGGCTGG - Intergenic
967356219 3:188574833-188574855 ATGTGTAAATTTCAGGAGGAGGG - Intronic
967682922 3:192385909-192385931 ACGTGGACATGCCTGGAGGAAGG + Intronic
967783382 3:193464261-193464283 ATGGGTAGAGGCCTGGAGGCAGG - Intronic
967893360 3:194378897-194378919 CTGAGCAAAGGCCTGGAGGCAGG + Intergenic
968098061 3:195946233-195946255 AAGTGCAAAGGCCTGGAGTCAGG - Intergenic
968106566 3:196005749-196005771 AAGTGCAAAGGCCTGGAGTCAGG - Intergenic
969052392 4:4382517-4382539 ATTTGCAAAGGCCTGGAGGCAGG + Intronic
970304431 4:14717142-14717164 ATTTGTATAGGCCAGCAGGAAGG - Intergenic
970561496 4:17285918-17285940 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
971314355 4:25554811-25554833 TTCTGTAGAGGACTGGAGGATGG + Intergenic
972039607 4:34576057-34576079 ATGTGTAAAAGCCAGAAGGATGG - Intergenic
972191316 4:36594511-36594533 AAGTGTAATGGCCTTGAGGAAGG - Intergenic
972289044 4:37673951-37673973 GTGTGCAAAGGCATGGAGGTGGG - Intronic
972417477 4:38856096-38856118 AGGTGGAAGGACCTGGAGGAAGG + Intronic
972557557 4:40195992-40196014 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
972997186 4:44895353-44895375 ATGTGCAATGGCCCTGAGGAGGG + Intergenic
974133067 4:57780275-57780297 AAGTGCAAAGGCCTTGAGGGAGG + Intergenic
974247730 4:59342526-59342548 ATGTTTAAAGGCATGTAGGAAGG + Intergenic
975114937 4:70669999-70670021 ATGTTTAAAGGCATGGAATAAGG - Intronic
975977222 4:80113196-80113218 ATGTTTAAAGACCTCAAGGAAGG - Intronic
976082223 4:81368366-81368388 ATGTGTCAAGGCGGGGAGGGGGG - Intergenic
976727096 4:88225390-88225412 ATTTTCAAAGGCTTGGAGGAAGG + Intronic
977660457 4:99579407-99579429 AAGTGCAAAGGCCCCGAGGAGGG - Intronic
981960458 4:150531344-150531366 AAATGGAAAGGCCTGGAGGGAGG - Intronic
982660644 4:158202166-158202188 TTCAGTGAAGGCCTGGAGGAGGG - Intronic
984189957 4:176593608-176593630 ATTTCTCAAGGCCTGGATGAAGG - Intergenic
985174850 4:187189804-187189826 AGGTGTAAAGGCAAGAAGGATGG - Intergenic
985764523 5:1769706-1769728 TTGTGGATAGGCCTGGAGGTGGG - Intergenic
987619031 5:20315374-20315396 ATTGGCAAAGGCCTGGAGAATGG - Intronic
989589262 5:43098356-43098378 ATGTGTTATGGCCTGTAGGGTGG - Intronic
990854441 5:60248261-60248283 AGGTGGAAAGGCCCTGAGGAGGG + Intronic
991046080 5:62224154-62224176 ATGTTTATAGGGATGGAGGAAGG + Intergenic
991051930 5:62282157-62282179 ATGTGAAAAAGCCTGGAGCCAGG + Intergenic
991177144 5:63702302-63702324 AAGGGTGAAGGACTGGAGGAGGG + Intergenic
991271587 5:64789622-64789644 ACATGTAAAGGCCTACAGGAAGG - Intronic
991400254 5:66244356-66244378 CTCTGCAAAGGCCTGGAGGTGGG - Intergenic
991499929 5:67267132-67267154 ATGTGCAAAGGCCCGGATGAGGG + Intergenic
994674530 5:102804084-102804106 AAGAGCACAGGCCTGGAGGAGGG + Intronic
995584116 5:113629122-113629144 AGGTGCAAAGGCCTTGAGGCAGG - Intergenic
996281983 5:121741125-121741147 ATGTGTAAAGGCTTATAGTAAGG + Intergenic
996337457 5:122400329-122400351 TAGTATAAAGGCCTGGAGGAAGG + Intronic
996396836 5:123021920-123021942 TTGTGCTAAGGCCTGAAGGAAGG - Intronic
997701095 5:135899941-135899963 AAGGGTAAAGGCCTGGAGGATGG - Intergenic
998035365 5:138910786-138910808 AAGTGCAAAAGCTTGGAGGAAGG + Intronic
998065308 5:139153168-139153190 ATGTGCAAAAGCCTGGAGGTGGG - Intronic
998253166 5:140566190-140566212 ATATGTAAAGGCCTTGTGGTAGG + Intronic
998477188 5:142431929-142431951 ATGTGCACAGGCCTGGAGGCTGG + Intergenic
998623763 5:143822991-143823013 ATGAGCAAAGGCCTGGAGGAGGG + Intergenic
998702747 5:144722828-144722850 GTGTTTAAAGGCTTGGATGATGG + Intergenic
998879593 5:146632810-146632832 ATGTGCAAAGGCCCTGAGGTGGG + Intronic
998954600 5:147426270-147426292 ATGTGCACAAGCCTGGAGGTAGG + Intronic
999032602 5:148310848-148310870 ATGTATGAAGACCTGGGGGAAGG - Intergenic
999448067 5:151657254-151657276 GAGTGCAAAGGCCTGGAGGCAGG + Intergenic
999483019 5:151966237-151966259 ATGTGCAAAGGTCCTGAGGAAGG + Intergenic
999540296 5:152564121-152564143 AGGTATAAAGGCCTTGAGAAGGG + Intergenic
999968957 5:156839805-156839827 ATGTGTAAAGGCCCCTAGGCAGG + Intergenic
1001442082 5:171750813-171750835 GTGAGCAAAGGCCTGGAGGCAGG - Intergenic
1001545587 5:172568730-172568752 ATGTGCAAAGGCCCAGAGGATGG + Intergenic
1001557525 5:172646831-172646853 ATGTGCAAAGGCCTGAGGGAGGG + Intronic
1001591900 5:172871319-172871341 AAGTGCAAAGGCCTCGAGGCAGG - Intronic
1001597531 5:172907648-172907670 ATGTGCAAAGGCCTGGAGGTTGG - Intronic
1001598842 5:172915846-172915868 AGGTGTCAGGGTCTGGAGGAAGG - Intronic
1001834768 5:174822633-174822655 AAGTGCAAAGGCCTTGAGGCAGG + Intergenic
1001965777 5:175908864-175908886 ATCTGCAGAGGCCTGGAGGCTGG - Intergenic
1002163497 5:177331202-177331224 ATGTGCAAGGGGCTGGAGGATGG - Intergenic
1002207049 5:177570091-177570113 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1002251168 5:177930332-177930354 ATCTGCAGAGGCCTGGAGGCTGG + Intergenic
1002350779 5:178582363-178582385 ATGTGCAGCTGCCTGGAGGAGGG + Intronic
1002367432 5:178724160-178724182 AGGTGGAAGGGCCTGGATGAAGG - Intronic
1002386017 5:178868010-178868032 AGGTGGAAGGGCCTGGATGAAGG + Intronic
1002575774 5:180172876-180172898 ATGGGCAAAGGCATGGAGGCGGG - Intronic
1002943216 6:1735635-1735657 ATGAGAAAAGGCATGGAGGCAGG - Intronic
1006811107 6:36821208-36821230 AGGTGAAAAGGCCTGGAGGCGGG + Intronic
1007667863 6:43526503-43526525 AAGTGCAAAGGCTTGGAGGTGGG + Intronic
1007735246 6:43978273-43978295 ATTTGCAGAGGCCTGGAGCAAGG - Intergenic
1007811853 6:44491896-44491918 ATGTCCAAGTGCCTGGAGGATGG + Intergenic
1007841302 6:44718002-44718024 ATGTGTAAAGGGCTTGAGATGGG - Intergenic
1008178138 6:48293485-48293507 ATGTGTGAATACCAGGAGGAAGG + Intergenic
1008656552 6:53619776-53619798 GTGTGGAAAGTCCTGGAGGGTGG - Intergenic
1009051725 6:58283728-58283750 ATGTTGAAAGGCTTGGAGGAAGG + Intergenic
1009567171 6:65324026-65324048 AGGTGTAAAGGCCCTGAGGTAGG - Intronic
1009905920 6:69869183-69869205 ATGTGTGAAGGCTTAGAGGTAGG + Intronic
1010422925 6:75694557-75694579 AGTTGCATAGGCCTGGAGGAGGG - Intronic
1012444331 6:99292767-99292789 ATGTGGAAAGGACTGGAGAAAGG - Intronic
1013143119 6:107359791-107359813 ATATGAAAAGTCCTGGAGGCGGG + Intronic
1014811268 6:125888962-125888984 CTCTGTACAGGCCTGGAGAATGG + Exonic
1015315445 6:131811277-131811299 ATGTGTAAAGGGCTTGCGTATGG + Intronic
1015555596 6:134458584-134458606 CTGCGTAAAGGCCTGAAGCAGGG - Intergenic
1015589124 6:134805463-134805485 GCGTGTAAAGGGCTGGAGGAGGG - Intergenic
1015686892 6:135874192-135874214 AAGTGCAAATGCCTGGAGGTGGG + Intronic
1015739611 6:136439792-136439814 AAGAGTAAAGGCCTGGAAGAAGG + Intronic
1016220677 6:141666753-141666775 AATTGTGAAGGCCTGGAGGCAGG - Intergenic
1016235386 6:141857627-141857649 ATGTGCAATGGCCTTGTGGAGGG + Intergenic
1017563605 6:155660532-155660554 ATGTAAAAAGGCTTGGGGGAAGG + Intergenic
1017610767 6:156184080-156184102 ATGTGTAAAAGACTAGAGGTAGG - Intergenic
1018829112 6:167428978-167429000 CTGTGCAGATGCCTGGAGGATGG - Intergenic
1019316733 7:390429-390451 ATGTGCAAAGGCCTCAAGGCAGG + Intergenic
1019637849 7:2085978-2086000 ATGTATGAAGGCCTGGAGGATGG + Intronic
1021262152 7:18471659-18471681 ATGTGCACAGGCCTGGAGTTAGG - Intronic
1021766556 7:23955772-23955794 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1022632602 7:32099746-32099768 ATATGTAAAGGCATGGTGTATGG - Intronic
1022635257 7:32126390-32126412 ATGTTTAAATGCCTGGAGTCTGG - Intronic
1022690764 7:32650531-32650553 ATGTGCAAAGGCCCTGAGGAAGG + Intergenic
1022918330 7:34984365-34984387 ATGTGCAAAGGCCCTGAGGAAGG + Intronic
1022944012 7:35264173-35264195 GTGTGTCAAAGCCTGTAGGAGGG + Intergenic
1022984397 7:35636724-35636746 ATGGGGAAAGGTCTGGAGGAAGG + Intronic
1022995756 7:35753804-35753826 ATGTGTAGAGGCCTGGAGAGAGG - Intergenic
1023095611 7:36656832-36656854 ATGTAAAAAGGCTTGGGGGAAGG + Intronic
1023179796 7:37470266-37470288 GTGTGTGAAGGCCCTGAGGATGG - Intergenic
1023563509 7:41500463-41500485 GTGAGAAAAGGCCTGGAGAAAGG + Intergenic
1023771117 7:43557437-43557459 ATGTGTGAGGGCCAGGAGAAAGG + Intronic
1023898872 7:44458857-44458879 ATGTGTATGAGCCTGGAGAAAGG + Intronic
1023898882 7:44459006-44459028 ATGTGTATGAGCCTGGAGAAAGG + Intronic
1025975672 7:66367720-66367742 ATGTGCAAAGGTCTTGAAGAGGG + Intronic
1026910979 7:74091820-74091842 ATGTGCAAAGGCCTTGGGGTGGG + Intronic
1027511189 7:79082390-79082412 ATTTGTACATGGCTGGAGGAAGG + Intronic
1028820016 7:95198054-95198076 ATGTGTAAAGTACTGCAGAATGG + Intronic
1030278205 7:107742983-107743005 AAGTGTAAAAGGCTGGAGAAAGG + Intergenic
1031691473 7:124793262-124793284 ATGTGCAAAAGCCTAGAGGTGGG - Intergenic
1032278844 7:130485188-130485210 ATGTGTAAAGGCACGGAGAAAGG + Intergenic
1032314996 7:130829381-130829403 ATGTGTACAGGCCTGGATCCTGG + Intergenic
1033710029 7:143933608-143933630 ACCTGTAAAGGCCAGAAGGAGGG - Intergenic
1033986074 7:147227185-147227207 AAGTGCAAAGGCCAGGAGGCAGG + Intronic
1034249903 7:149681260-149681282 ACCTGTAAGTGCCTGGAGGATGG - Intergenic
1034291109 7:149932653-149932675 ATGTCTTAATTCCTGGAGGAAGG + Intergenic
1034814994 7:154164284-154164306 ATGTCTTAATTCCTGGAGGAAGG - Intronic
1035849947 8:2908635-2908657 GAGTTTAAAGGCCTGGAAGATGG + Intergenic
1038145125 8:24888320-24888342 ACGTGTGAAGGCCCTGAGGAGGG + Intergenic
1038156743 8:24998631-24998653 ATCTGGAAATGCCTCGAGGAAGG - Intergenic
1039025372 8:33252698-33252720 ATATGTAAAGCCCTGGATGGAGG + Intergenic
1039861805 8:41465678-41465700 GAGTGTCAAGGCCTGGAAGAAGG - Intergenic
1039969199 8:42307183-42307205 AGGTGAAAAGGGCTGGAGGTGGG + Intronic
1040010832 8:42659795-42659817 ATGAGAAAAGTCCTGGAGAAGGG - Intergenic
1040882823 8:52226202-52226224 TTGTTGAAAGGCCTGAAGGAAGG - Intronic
1041012343 8:53557660-53557682 AACAGTAAAGGGCTGGAGGAGGG + Intergenic
1041191711 8:55361800-55361822 AGGTGCAAAGGCCTGGAGGTGGG - Intronic
1042230902 8:66553377-66553399 ATGAGTAAAAGGCTGGAGAATGG - Intergenic
1042661146 8:71155823-71155845 ATGTGTAAAGGCTAAAAGGAGGG + Intergenic
1042770262 8:72372882-72372904 ATTTGCAAGGGCCTGGAAGAAGG - Intergenic
1042884353 8:73531339-73531361 ATGTGGCAAGGCACGGAGGAAGG + Intronic
1044670498 8:94675747-94675769 ATCTGTAATGACCAGGAGGAGGG - Intronic
1045550520 8:103167636-103167658 ATGTGCAAAGGCCTTGAGGCAGG + Intronic
1045593410 8:103625129-103625151 ATATGTAAAGGGCTGGGGCAGGG + Intronic
1046151917 8:110238582-110238604 ACGTGTAAGGGCATGGAGGCCGG + Intergenic
1046438442 8:114227020-114227042 ATGTATAATGGCCTGGAATAAGG - Intergenic
1046794335 8:118354412-118354434 ATGAGCAAAGGCTGGGAGGAAGG - Intronic
1047136878 8:122089355-122089377 ATGGGTAAGGGAGTGGAGGAGGG + Intergenic
1047957786 8:129988455-129988477 ACGTGCAAATGCCTGGAGGTGGG - Intronic
1048271717 8:133033651-133033673 AGATAAAAAGGCCTGGAGGAAGG - Intronic
1049240074 8:141533202-141533224 AAGGGTGAATGCCTGGAGGAAGG - Intergenic
1049475345 8:142794606-142794628 ATGTGCAAAGGCCCGGAGGTAGG - Intergenic
1050598433 9:7227067-7227089 ATGTGTCAATGCCTGGAGGTGGG + Intergenic
1051114003 9:13673522-13673544 ATGTGCAAAGGCCCTGAGGCAGG + Intergenic
1051564845 9:18485843-18485865 GAGTGGAAAGGCCTGGAGAAGGG + Intronic
1051681355 9:19611184-19611206 ATGTGTAAGGGCCCTGAGGCAGG + Intronic
1051747954 9:20313037-20313059 ATGTGCAAAGGCATGGAAGCAGG + Intergenic
1053090348 9:35269627-35269649 ATGTGATAACTCCTGGAGGATGG - Intronic
1053286330 9:36851721-36851743 ATGAGCAAAGGCAGGGAGGAGGG + Intronic
1053351318 9:37415121-37415143 GTGAGCAAAGGCCTGGAGGCTGG - Intergenic
1053796658 9:41732768-41732790 AGGTGTAAAGGTCTGAAGCATGG + Intergenic
1054148525 9:61582093-61582115 AGGTGTAAAGGTCTGAAGCATGG - Intergenic
1054185071 9:61944843-61944865 AGGTGTAAAGGTCTGAAGCATGG + Intergenic
1054468279 9:65513188-65513210 AGGTGTAAAGGTCTGAAGCATGG - Intergenic
1054653438 9:67643653-67643675 AGGTGTAAAGGTCTGAAGCATGG - Intergenic
1054703219 9:68435012-68435034 TTGAGCAAAGGCCTGGAGGCAGG - Intronic
1057833003 9:98420799-98420821 CTGTGTAAAGGCCTGGAGGTGGG + Intronic
1058785221 9:108380475-108380497 AGGTCTAATGGGCTGGAGGAAGG - Intergenic
1059454367 9:114390232-114390254 ATGAGCAAAGGCAGGGAGGAGGG - Intronic
1060124826 9:121033501-121033523 ATGTGCAAAGGCACGGAGGTAGG + Intronic
1061278868 9:129585647-129585669 ATCTGAAGAGGCCTGGTGGATGG - Intergenic
1185667966 X:1782621-1782643 TTTTGTAAAGTCCTGGAGGCTGG + Intergenic
1187452556 X:19411737-19411759 AAGTGCAAAGGCCCTGAGGAGGG + Intronic
1188829038 X:34873675-34873697 CTGTGTAAAGGCCGCCAGGAGGG + Intergenic
1189527101 X:41834535-41834557 AAGTGGGAAGGCCTGGGGGAAGG - Intronic
1190285784 X:48960503-48960525 ATGTGCAATGACCTGGAGGTTGG - Intergenic
1190744738 X:53315797-53315819 CAGAGTAAAGGCCTGGAGCATGG - Intronic
1192197056 X:69035399-69035421 ATGTGCAAAGGCCCAGAGGCAGG - Intergenic
1192387096 X:70681804-70681826 ATTGGTAAATGCCTGGAGGGAGG + Intronic
1192925367 X:75749873-75749895 TGGTGTAAATGCCTGGTGGAGGG + Intergenic
1193859983 X:86653379-86653401 ATGTCTAAAAGCGTGGTGGAAGG + Intronic
1194644476 X:96441815-96441837 AAGTGTAAAGGCCTTGAGGTGGG + Intergenic
1195304154 X:103562652-103562674 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1195409488 X:104554509-104554531 AAGTGCAAAGGCCTTGAGGCAGG - Intergenic
1196174874 X:112629450-112629472 AATGGTCAAGGCCTGGAGGAAGG - Intergenic
1197193598 X:123676183-123676205 GTCTGTAATGGCCTGGAGCAAGG - Intronic
1198176969 X:134166105-134166127 AAGTTTGGAGGCCTGGAGGAAGG - Intergenic
1198764894 X:140070491-140070513 ATGTAAAAAGGCTTGGAGGAGGG + Intergenic
1199115723 X:143989738-143989760 ATGAATAAATGCCTGGAGGGAGG + Intergenic
1199452929 X:147993720-147993742 GTGAGTGAAGGCCTGGAGGAGGG - Intronic
1199778291 X:151034819-151034841 ATGTGCAAAGGCCCTGAGGCAGG - Intergenic
1200317543 X:155149361-155149383 ATGTGCAAAGGCCCTGGGGAAGG - Intergenic
1200766152 Y:7082607-7082629 ATGTAAATGGGCCTGGAGGATGG - Intronic
1201486380 Y:14498752-14498774 ATATGGAAAGGCCTGTAGCAAGG - Intergenic