ID: 928572958

View in Genome Browser
Species Human (GRCh38)
Location 2:32627191-32627213
Sequence CGGGGGAATTGCTTGAACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928572958_928572973 27 Left 928572958 2:32627191-32627213 CCCGGGTTCAAGCAATTCCCCCG No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data
928572958_928572968 8 Left 928572958 2:32627191-32627213 CCCGGGTTCAAGCAATTCCCCCG No data
Right 928572968 2:32627222-32627244 TCCCGAGTAGCTGGGTTTACAGG No data
928572958_928572964 -1 Left 928572958 2:32627191-32627213 CCCGGGTTCAAGCAATTCCCCCG No data
Right 928572964 2:32627213-32627235 GCCTCACCGTCCCGAGTAGCTGG No data
928572958_928572972 10 Left 928572958 2:32627191-32627213 CCCGGGTTCAAGCAATTCCCCCG No data
Right 928572972 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG No data
928572958_928572970 9 Left 928572958 2:32627191-32627213 CCCGGGTTCAAGCAATTCCCCCG No data
Right 928572970 2:32627223-32627245 CCCGAGTAGCTGGGTTTACAGGG No data
928572958_928572966 0 Left 928572958 2:32627191-32627213 CCCGGGTTCAAGCAATTCCCCCG No data
Right 928572966 2:32627214-32627236 CCTCACCGTCCCGAGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928572958 Original CRISPR CGGGGGAATTGCTTGAACCC GGG (reversed) Intergenic