ID: 928572961

View in Genome Browser
Species Human (GRCh38)
Location 2:32627209-32627231
Sequence CTACTCGGGACGGTGAGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928572961_928572973 9 Left 928572961 2:32627209-32627231 CCCCGCCTCACCGTCCCGAGTAG No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data
928572961_928572968 -10 Left 928572961 2:32627209-32627231 CCCCGCCTCACCGTCCCGAGTAG No data
Right 928572968 2:32627222-32627244 TCCCGAGTAGCTGGGTTTACAGG No data
928572961_928572970 -9 Left 928572961 2:32627209-32627231 CCCCGCCTCACCGTCCCGAGTAG No data
Right 928572970 2:32627223-32627245 CCCGAGTAGCTGGGTTTACAGGG No data
928572961_928572972 -8 Left 928572961 2:32627209-32627231 CCCCGCCTCACCGTCCCGAGTAG No data
Right 928572972 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928572961 Original CRISPR CTACTCGGGACGGTGAGGCG GGG (reversed) Intergenic