ID: 928572962

View in Genome Browser
Species Human (GRCh38)
Location 2:32627210-32627232
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928572962_928572973 8 Left 928572962 2:32627210-32627232 CCCGCCTCACCGTCCCGAGTAGC No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data
928572962_928572972 -9 Left 928572962 2:32627210-32627232 CCCGCCTCACCGTCCCGAGTAGC No data
Right 928572972 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG No data
928572962_928572970 -10 Left 928572962 2:32627210-32627232 CCCGCCTCACCGTCCCGAGTAGC No data
Right 928572970 2:32627223-32627245 CCCGAGTAGCTGGGTTTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928572962 Original CRISPR GCTACTCGGGACGGTGAGGC GGG (reversed) Intergenic