ID: 928572963

View in Genome Browser
Species Human (GRCh38)
Location 2:32627211-32627233
Sequence AGCTACTCGGGACGGTGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99135
Summary {0: 1, 1: 107, 2: 7458, 3: 41156, 4: 50413}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928572963_928572972 -10 Left 928572963 2:32627211-32627233 CCGCCTCACCGTCCCGAGTAGCT 0: 1
1: 107
2: 7458
3: 41156
4: 50413
Right 928572972 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG 0: 2
1: 410
2: 2069
3: 2769
4: 2485
928572963_928572973 7 Left 928572963 2:32627211-32627233 CCGCCTCACCGTCCCGAGTAGCT 0: 1
1: 107
2: 7458
3: 41156
4: 50413
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG 0: 1
1: 0
2: 13
3: 601
4: 8911

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928572963 Original CRISPR AGCTACTCGGGACGGTGAGG CGG (reversed) Intergenic
Too many off-targets to display for this crispr