ID: 928572963

View in Genome Browser
Species Human (GRCh38)
Location 2:32627211-32627233
Sequence AGCTACTCGGGACGGTGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928572963_928572972 -10 Left 928572963 2:32627211-32627233 CCGCCTCACCGTCCCGAGTAGCT No data
Right 928572972 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG No data
928572963_928572973 7 Left 928572963 2:32627211-32627233 CCGCCTCACCGTCCCGAGTAGCT No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928572963 Original CRISPR AGCTACTCGGGACGGTGAGG CGG (reversed) Intergenic