ID: 928572963 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:32627211-32627233 |
| Sequence | AGCTACTCGGGACGGTGAGG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 99135 | |||
| Summary | {0: 1, 1: 107, 2: 7458, 3: 41156, 4: 50413} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 928572963_928572972 | -10 | Left | 928572963 | 2:32627211-32627233 | CCGCCTCACCGTCCCGAGTAGCT | 0: 1 1: 107 2: 7458 3: 41156 4: 50413 |
||
| Right | 928572972 | 2:32627224-32627246 | CCGAGTAGCTGGGTTTACAGGGG | 0: 2 1: 410 2: 2069 3: 2769 4: 2485 |
||||
| 928572963_928572973 | 7 | Left | 928572963 | 2:32627211-32627233 | CCGCCTCACCGTCCCGAGTAGCT | 0: 1 1: 107 2: 7458 3: 41156 4: 50413 |
||
| Right | 928572973 | 2:32627241-32627263 | CAGGGGTGCCCCACTACGTCCGG | 0: 1 1: 0 2: 13 3: 601 4: 8911 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 928572963 | Original CRISPR | AGCTACTCGGGACGGTGAGG CGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||