ID: 928572963 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:32627211-32627233 |
Sequence | AGCTACTCGGGACGGTGAGG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
928572963_928572972 | -10 | Left | 928572963 | 2:32627211-32627233 | CCGCCTCACCGTCCCGAGTAGCT | No data | ||
Right | 928572972 | 2:32627224-32627246 | CCGAGTAGCTGGGTTTACAGGGG | No data | ||||
928572963_928572973 | 7 | Left | 928572963 | 2:32627211-32627233 | CCGCCTCACCGTCCCGAGTAGCT | No data | ||
Right | 928572973 | 2:32627241-32627263 | CAGGGGTGCCCCACTACGTCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
928572963 | Original CRISPR | AGCTACTCGGGACGGTGAGG CGG (reversed) | Intergenic | ||