ID: 928572965

View in Genome Browser
Species Human (GRCh38)
Location 2:32627214-32627236
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928572965_928572973 4 Left 928572965 2:32627214-32627236 CCTCACCGTCCCGAGTAGCTGGG No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928572965 Original CRISPR CCCAGCTACTCGGGACGGTG AGG (reversed) Intergenic