ID: 928572967

View in Genome Browser
Species Human (GRCh38)
Location 2:32627219-32627241
Sequence GTAAACCCAGCTACTCGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928572967_928572973 -1 Left 928572967 2:32627219-32627241 CCGTCCCGAGTAGCTGGGTTTAC No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data
928572967_928572979 28 Left 928572967 2:32627219-32627241 CCGTCCCGAGTAGCTGGGTTTAC No data
Right 928572979 2:32627270-32627292 TTTGTATTTTTAGTAGAGACGGG No data
928572967_928572978 27 Left 928572967 2:32627219-32627241 CCGTCCCGAGTAGCTGGGTTTAC No data
Right 928572978 2:32627269-32627291 TTTTGTATTTTTAGTAGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928572967 Original CRISPR GTAAACCCAGCTACTCGGGA CGG (reversed) Intergenic