ID: 928572969

View in Genome Browser
Species Human (GRCh38)
Location 2:32627223-32627245
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928572969_928572973 -5 Left 928572969 2:32627223-32627245 CCCGAGTAGCTGGGTTTACAGGG No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data
928572969_928572979 24 Left 928572969 2:32627223-32627245 CCCGAGTAGCTGGGTTTACAGGG No data
Right 928572979 2:32627270-32627292 TTTGTATTTTTAGTAGAGACGGG No data
928572969_928572978 23 Left 928572969 2:32627223-32627245 CCCGAGTAGCTGGGTTTACAGGG No data
Right 928572978 2:32627269-32627291 TTTTGTATTTTTAGTAGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928572969 Original CRISPR CCCTGTAAACCCAGCTACTC GGG (reversed) Intergenic