ID: 928572970

View in Genome Browser
Species Human (GRCh38)
Location 2:32627223-32627245
Sequence CCCGAGTAGCTGGGTTTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928572957_928572970 12 Left 928572957 2:32627188-32627210 CCTCCCGGGTTCAAGCAATTCCC No data
Right 928572970 2:32627223-32627245 CCCGAGTAGCTGGGTTTACAGGG No data
928572962_928572970 -10 Left 928572962 2:32627210-32627232 CCCGCCTCACCGTCCCGAGTAGC No data
Right 928572970 2:32627223-32627245 CCCGAGTAGCTGGGTTTACAGGG No data
928572961_928572970 -9 Left 928572961 2:32627209-32627231 CCCCGCCTCACCGTCCCGAGTAG No data
Right 928572970 2:32627223-32627245 CCCGAGTAGCTGGGTTTACAGGG No data
928572956_928572970 15 Left 928572956 2:32627185-32627207 CCGCCTCCCGGGTTCAAGCAATT No data
Right 928572970 2:32627223-32627245 CCCGAGTAGCTGGGTTTACAGGG No data
928572959_928572970 8 Left 928572959 2:32627192-32627214 CCGGGTTCAAGCAATTCCCCCGC No data
Right 928572970 2:32627223-32627245 CCCGAGTAGCTGGGTTTACAGGG No data
928572958_928572970 9 Left 928572958 2:32627191-32627213 CCCGGGTTCAAGCAATTCCCCCG No data
Right 928572970 2:32627223-32627245 CCCGAGTAGCTGGGTTTACAGGG No data
928572955_928572970 18 Left 928572955 2:32627182-32627204 CCTCCGCCTCCCGGGTTCAAGCA No data
Right 928572970 2:32627223-32627245 CCCGAGTAGCTGGGTTTACAGGG No data
928572960_928572970 -8 Left 928572960 2:32627208-32627230 CCCCCGCCTCACCGTCCCGAGTA No data
Right 928572970 2:32627223-32627245 CCCGAGTAGCTGGGTTTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928572970 Original CRISPR CCCGAGTAGCTGGGTTTACA GGG Intergenic