ID: 928572971

View in Genome Browser
Species Human (GRCh38)
Location 2:32627224-32627246
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928572971_928572979 23 Left 928572971 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG No data
Right 928572979 2:32627270-32627292 TTTGTATTTTTAGTAGAGACGGG No data
928572971_928572978 22 Left 928572971 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG No data
Right 928572978 2:32627269-32627291 TTTTGTATTTTTAGTAGAGACGG No data
928572971_928572973 -6 Left 928572971 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928572971 Original CRISPR CCCCTGTAAACCCAGCTACT CGG (reversed) Intergenic