ID: 928572972

View in Genome Browser
Species Human (GRCh38)
Location 2:32627224-32627246
Sequence CCGAGTAGCTGGGTTTACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7735
Summary {0: 2, 1: 410, 2: 2069, 3: 2769, 4: 2485}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928572961_928572972 -8 Left 928572961 2:32627209-32627231 CCCCGCCTCACCGTCCCGAGTAG 0: 1
1: 1
2: 88
3: 2646
4: 8536
Right 928572972 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG 0: 2
1: 410
2: 2069
3: 2769
4: 2485
928572963_928572972 -10 Left 928572963 2:32627211-32627233 CCGCCTCACCGTCCCGAGTAGCT 0: 1
1: 107
2: 7458
3: 41156
4: 50413
Right 928572972 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG 0: 2
1: 410
2: 2069
3: 2769
4: 2485
928572959_928572972 9 Left 928572959 2:32627192-32627214 CCGGGTTCAAGCAATTCCCCCGC 0: 15
1: 1597
2: 36076
3: 90708
4: 164127
Right 928572972 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG 0: 2
1: 410
2: 2069
3: 2769
4: 2485
928572955_928572972 19 Left 928572955 2:32627182-32627204 CCTCCGCCTCCCGGGTTCAAGCA 0: 5022
1: 35477
2: 98334
3: 141689
4: 137981
Right 928572972 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG 0: 2
1: 410
2: 2069
3: 2769
4: 2485
928572962_928572972 -9 Left 928572962 2:32627210-32627232 CCCGCCTCACCGTCCCGAGTAGC 0: 6
1: 982
2: 96305
3: 250962
4: 200826
Right 928572972 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG 0: 2
1: 410
2: 2069
3: 2769
4: 2485
928572956_928572972 16 Left 928572956 2:32627185-32627207 CCGCCTCCCGGGTTCAAGCAATT 0: 9588
1: 51717
2: 117050
3: 131419
4: 77213
Right 928572972 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG 0: 2
1: 410
2: 2069
3: 2769
4: 2485
928572960_928572972 -7 Left 928572960 2:32627208-32627230 CCCCCGCCTCACCGTCCCGAGTA 0: 1
1: 0
2: 87
3: 2244
4: 7321
Right 928572972 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG 0: 2
1: 410
2: 2069
3: 2769
4: 2485
928572957_928572972 13 Left 928572957 2:32627188-32627210 CCTCCCGGGTTCAAGCAATTCCC 0: 381
1: 16456
2: 81601
3: 176788
4: 200979
Right 928572972 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG 0: 2
1: 410
2: 2069
3: 2769
4: 2485
928572958_928572972 10 Left 928572958 2:32627191-32627213 CCCGGGTTCAAGCAATTCCCCCG 0: 13
1: 1311
2: 37307
3: 114983
4: 233129
Right 928572972 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG 0: 2
1: 410
2: 2069
3: 2769
4: 2485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928572972 Original CRISPR CCGAGTAGCTGGGTTTACAG GGG Intergenic
Too many off-targets to display for this crispr