ID: 928572973

View in Genome Browser
Species Human (GRCh38)
Location 2:32627241-32627263
Sequence CAGGGGTGCCCCACTACGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9526
Summary {0: 1, 1: 0, 2: 13, 3: 601, 4: 8911}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928572961_928572973 9 Left 928572961 2:32627209-32627231 CCCCGCCTCACCGTCCCGAGTAG 0: 1
1: 1
2: 88
3: 2646
4: 8536
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG 0: 1
1: 0
2: 13
3: 601
4: 8911
928572962_928572973 8 Left 928572962 2:32627210-32627232 CCCGCCTCACCGTCCCGAGTAGC 0: 6
1: 982
2: 96305
3: 250962
4: 200826
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG 0: 1
1: 0
2: 13
3: 601
4: 8911
928572969_928572973 -5 Left 928572969 2:32627223-32627245 CCCGAGTAGCTGGGTTTACAGGG 0: 8
1: 1821
2: 111338
3: 257250
4: 227823
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG 0: 1
1: 0
2: 13
3: 601
4: 8911
928572971_928572973 -6 Left 928572971 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG 0: 2
1: 1119
2: 52436
3: 179085
4: 167470
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG 0: 1
1: 0
2: 13
3: 601
4: 8911
928572957_928572973 30 Left 928572957 2:32627188-32627210 CCTCCCGGGTTCAAGCAATTCCC 0: 381
1: 16456
2: 81601
3: 176788
4: 200979
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG 0: 1
1: 0
2: 13
3: 601
4: 8911
928572958_928572973 27 Left 928572958 2:32627191-32627213 CCCGGGTTCAAGCAATTCCCCCG 0: 13
1: 1311
2: 37307
3: 114983
4: 233129
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG 0: 1
1: 0
2: 13
3: 601
4: 8911
928572960_928572973 10 Left 928572960 2:32627208-32627230 CCCCCGCCTCACCGTCCCGAGTA 0: 1
1: 0
2: 87
3: 2244
4: 7321
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG 0: 1
1: 0
2: 13
3: 601
4: 8911
928572965_928572973 4 Left 928572965 2:32627214-32627236 CCTCACCGTCCCGAGTAGCTGGG 0: 5
1: 1114
2: 107853
3: 295475
4: 225593
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG 0: 1
1: 0
2: 13
3: 601
4: 8911
928572959_928572973 26 Left 928572959 2:32627192-32627214 CCGGGTTCAAGCAATTCCCCCGC 0: 15
1: 1597
2: 36076
3: 90708
4: 164127
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG 0: 1
1: 0
2: 13
3: 601
4: 8911
928572963_928572973 7 Left 928572963 2:32627211-32627233 CCGCCTCACCGTCCCGAGTAGCT 0: 1
1: 107
2: 7458
3: 41156
4: 50413
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG 0: 1
1: 0
2: 13
3: 601
4: 8911
928572967_928572973 -1 Left 928572967 2:32627219-32627241 CCGTCCCGAGTAGCTGGGTTTAC 0: 6
1: 589
2: 2585
3: 3877
4: 4283
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG 0: 1
1: 0
2: 13
3: 601
4: 8911

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928572973 Original CRISPR CAGGGGTGCCCCACTACGTC CGG Intergenic
Too many off-targets to display for this crispr