ID: 928572973

View in Genome Browser
Species Human (GRCh38)
Location 2:32627241-32627263
Sequence CAGGGGTGCCCCACTACGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928572967_928572973 -1 Left 928572967 2:32627219-32627241 CCGTCCCGAGTAGCTGGGTTTAC No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data
928572959_928572973 26 Left 928572959 2:32627192-32627214 CCGGGTTCAAGCAATTCCCCCGC No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data
928572961_928572973 9 Left 928572961 2:32627209-32627231 CCCCGCCTCACCGTCCCGAGTAG No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data
928572969_928572973 -5 Left 928572969 2:32627223-32627245 CCCGAGTAGCTGGGTTTACAGGG No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data
928572957_928572973 30 Left 928572957 2:32627188-32627210 CCTCCCGGGTTCAAGCAATTCCC No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data
928572965_928572973 4 Left 928572965 2:32627214-32627236 CCTCACCGTCCCGAGTAGCTGGG No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data
928572958_928572973 27 Left 928572958 2:32627191-32627213 CCCGGGTTCAAGCAATTCCCCCG No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data
928572971_928572973 -6 Left 928572971 2:32627224-32627246 CCGAGTAGCTGGGTTTACAGGGG No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data
928572963_928572973 7 Left 928572963 2:32627211-32627233 CCGCCTCACCGTCCCGAGTAGCT No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data
928572962_928572973 8 Left 928572962 2:32627210-32627232 CCCGCCTCACCGTCCCGAGTAGC No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data
928572960_928572973 10 Left 928572960 2:32627208-32627230 CCCCCGCCTCACCGTCCCGAGTA No data
Right 928572973 2:32627241-32627263 CAGGGGTGCCCCACTACGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928572973 Original CRISPR CAGGGGTGCCCCACTACGTC CGG Intergenic