ID: 928575822

View in Genome Browser
Species Human (GRCh38)
Location 2:32653999-32654021
Sequence TGGGACCCTTGGGGAAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928575822 Original CRISPR TGGGACCCTTGGGGAAGAAC TGG (reversed) Intronic
900237046 1:1597917-1597939 TGGGACCCTTGGGTATGGGCTGG - Intergenic
901133134 1:6975201-6975223 TGTGAGCCTTGGGGAAAAATAGG + Intronic
902372242 1:16014094-16014116 TGGGCCCCTTGGGGGAGGACTGG - Exonic
902658719 1:17886985-17887007 AGGGACACTCGGGTAAGAACTGG - Intergenic
902880680 1:19370069-19370091 TGGGAGCCTTGGGAAAGGTCTGG - Intronic
903070973 1:20726878-20726900 GGGGACCCCAGGGGAAGCACGGG + Intronic
903382253 1:22905459-22905481 AGGGACCCTGGGGGAAGAGGAGG + Intronic
903951756 1:26999686-26999708 TGGGACTCCTGGGGAAGCAGAGG - Intronic
904848583 1:33439662-33439684 AGGGATCCTAGGGGAGGAACTGG - Intergenic
905334425 1:37234505-37234527 TGAGATACTTGGGGAAGAGCTGG - Intergenic
906272468 1:44491172-44491194 TGGAAGACTTGGTGAAGAACTGG - Intronic
907131456 1:52100955-52100977 AGGTCCCTTTGGGGAAGAACTGG + Intergenic
908181482 1:61610530-61610552 TAGGTGCCTTGGGGAAGGACTGG - Intergenic
909648036 1:77939033-77939055 TGGGACCATGGAGGATGAACTGG + Intronic
909674472 1:78223842-78223864 TGGGTCACTTGGTGAAGAATGGG + Intergenic
909811056 1:79932158-79932180 TGGGACCATTGGGCAATGACAGG - Intergenic
910369325 1:86499098-86499120 AGTGACTCCTGGGGAAGAACTGG + Intronic
915709773 1:157884470-157884492 TGGGCCCCTTGGGCAATGACAGG - Intronic
918580506 1:186121573-186121595 TGGAACGCAAGGGGAAGAACTGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063967153 10:11355034-11355056 TGGGATGCTTGGGGCAGAAAAGG + Intergenic
1070510955 10:77160123-77160145 TGACACCCTTGGAGAAGAGCAGG - Intronic
1070820795 10:79352998-79353020 TGGGGCACCTGGGGATGAACTGG + Intronic
1072265478 10:93722791-93722813 CTGGAGCCTTGGAGAAGAACAGG + Intergenic
1073097004 10:100985970-100985992 TGAGAACCTTGGGGAAGGGCAGG - Intronic
1074048520 10:109861249-109861271 AGGCTGCCTTGGGGAAGAACAGG + Intergenic
1074777148 10:116774931-116774953 TGGGGCCCTTGGGGAGGGAGTGG - Intergenic
1075479678 10:122769109-122769131 TGAGGCCCCTGGGGAAGTACTGG + Intergenic
1075843445 10:125524678-125524700 TGGCACCCTTGTCGAAGATCCGG + Intergenic
1076699565 10:132264450-132264472 TGGGGACCTTGAGGAAGAAAGGG + Intronic
1077186116 11:1236157-1236179 TGGGAACCTTGGGGCTGCACGGG - Intronic
1078529153 11:12122973-12122995 TGGCACCCAAGGGGAAGAACTGG - Intronic
1078774859 11:14384500-14384522 TGAGTTCCTTTGGGAAGAACTGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081981301 11:47268991-47269013 TGGGGCCCTGTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084574034 11:69977262-69977284 TGGGACCACTGGGGATGGACTGG - Intergenic
1085348598 11:75783936-75783958 TGGGCCCTTTGGGGAAGCAAAGG + Intronic
1085715842 11:78872483-78872505 TGGCACACTTGGGAAATAACAGG - Intronic
1086093160 11:83024042-83024064 GGGGCCTCTTGGGGAAGGACTGG + Intronic
1089088540 11:115845701-115845723 AGGGACCTTTGGAGAAGAACAGG + Intergenic
1090355446 11:126137505-126137527 TGGGAGTCTTGAGGTAGAACTGG + Intergenic
1091194508 11:133719822-133719844 TGGGACGCTTGGGGCAGGAAAGG + Intergenic
1092245941 12:6864221-6864243 TGGGGCCAGTGGGGAAGAAGGGG + Intronic
1093031756 12:14295131-14295153 TGGGACCATTGGGCAATCACTGG + Intergenic
1093036453 12:14336479-14336501 TGGGACCATTGGGCAATCACCGG - Intergenic
1094056428 12:26273779-26273801 TGGGGCATTTGGGGAAGAAGAGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094723930 12:33092867-33092889 TGGGACCCTTGAGGGTGAAAAGG + Intergenic
1096315277 12:50559157-50559179 TCTGTCCCTTGGGGAAGTACTGG - Intronic
1096880603 12:54666010-54666032 AGGGTTCCTTGGGGAAGAGCAGG - Intergenic
1096969953 12:55657658-55657680 AGGGATCCTGGGGGAGGAACAGG + Intergenic
1097492454 12:60287254-60287276 TTGGACCCTTGGGGAAGCACAGG + Intergenic
1097534532 12:60849999-60850021 GGAGAACCTTGGGGAAGAGCTGG - Intergenic
1097821239 12:64131104-64131126 TGGGCCCATTGAGCAAGAACAGG + Intronic
1099346933 12:81512690-81512712 TGGGACTTGTGGGGAAGAATGGG - Intronic
1100083411 12:90879010-90879032 TGGGTCCATTGGGCAAGGACTGG - Intergenic
1102165624 12:110804225-110804247 TTGGAACCTTGAGGATGAACTGG - Intergenic
1102187159 12:110957783-110957805 TCGGGCCCTTGGGGAGGGACGGG - Intergenic
1102266735 12:111492240-111492262 TGGTAGTCTTGGGGAAGATCTGG - Intronic
1103140828 12:118546721-118546743 TGGGACCCATGGAGAGGCACAGG - Intergenic
1103318915 12:120079058-120079080 CGGAAGCCTCGGGGAAGAACAGG - Intronic
1104141797 12:125994513-125994535 TGGGGCCCTTGGGGAAGCCTTGG + Intergenic
1104832297 12:131761598-131761620 TGGCAGCCTTGGGAAGGAACTGG + Intronic
1104962683 12:132495682-132495704 TGGGACTCTGTGGGAGGAACAGG - Intronic
1106054697 13:26227428-26227450 TGGGCCCCTTGTGCGAGAACTGG + Intergenic
1107935574 13:45342669-45342691 TGCAACCCTTGGGAAAGAGCAGG + Intergenic
1109469546 13:62787785-62787807 TGGAACTCTTGGGGGAAAACAGG + Intergenic
1113799075 13:113077244-113077266 TGGGACCCTCGGGGGAGCCCCGG + Intronic
1114551835 14:23537292-23537314 TGGGACCTTGGGGGAAGTATAGG - Intronic
1116216356 14:42022359-42022381 TTGGAACCTTGGGGAGGAAATGG + Intergenic
1116554017 14:46279850-46279872 TGAGACCCTTGGCAAAGATCTGG - Intergenic
1118772132 14:68949254-68949276 TGGGAGCCCTGGGGAGGCACGGG - Intronic
1118880665 14:69823212-69823234 TGGGACCTTTGGGCAATGACAGG + Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119655976 14:76417315-76417337 TGGCACACTTGGGGAAGAGCAGG + Intronic
1121228261 14:92337493-92337515 TCGGTGCCTTGGGGAAGATCAGG + Intronic
1121228438 14:92339043-92339065 TCGGTGCCTTGGGGAAGATCAGG + Intronic
1122245914 14:100403417-100403439 TGGGACTCCTGGGAAGGAACTGG + Intronic
1122345905 14:101059996-101060018 TGCCACCTTTGGGGAAGAAGTGG + Intergenic
1124595153 15:31086166-31086188 TGGGACCACTGGGGAACACCTGG + Intronic
1125747312 15:42005636-42005658 TGGGACTCTGAGGGAAGAAAAGG + Intronic
1126085477 15:45007295-45007317 TGGAACTCTTAGGGAAAAACAGG + Intergenic
1126788084 15:52195533-52195555 TGGGAACCATTGGGAAGCACAGG + Intronic
1128376163 15:67077628-67077650 TGGGAGCCTAGAGGAAGAACAGG + Intronic
1131249165 15:90819508-90819530 TGGGACCCATGGGGACAGACAGG - Intergenic
1131272915 15:90957622-90957644 TGGGACCCTGGAGGCAGAGCTGG + Exonic
1132655911 16:1041580-1041602 GGGGACCCTTGGGGAAAAGTGGG - Intergenic
1132899613 16:2246106-2246128 TGGGACCCTTGAGGAGAAGCGGG - Intronic
1133999315 16:10770234-10770256 TGGCACCCGTGTGGAGGAACTGG - Intronic
1134387982 16:13792146-13792168 TGGGACCAGTGGGGAAACACGGG - Intergenic
1134466556 16:14483993-14484015 TGGGACTCCAGGGGAAGGACAGG - Intronic
1134818679 16:17227927-17227949 TGGGCAACTTGGGGAATAACAGG + Intronic
1135705418 16:24670823-24670845 GTGGACCCTTGGGGAACAAGTGG + Intergenic
1135969078 16:27059174-27059196 GGAGACCCTTGGGGAAGAGTAGG + Intergenic
1136834770 16:33493121-33493143 TGGGGGAGTTGGGGAAGAACTGG - Intergenic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1138190074 16:55007599-55007621 TGGGACCCATGGGGCAGAGAAGG + Intergenic
1142231969 16:88904203-88904225 TGGTTCCCTTTGGGCAGAACAGG + Intronic
1142243188 16:88956375-88956397 TGAGACCCCTGGGGAAGAGCAGG - Intronic
1203010033 16_KI270728v1_random:230911-230933 TGGGGGAGTTGGGGAAGAACTGG + Intergenic
1145018228 17:19412481-19412503 TGGGACCTGTGGGGCAAAACAGG - Exonic
1145294215 17:21575174-21575196 TGAGACCCTTAGGGAAGGACAGG + Intergenic
1145369617 17:22298012-22298034 TGAGACCCTTAGGGAAGGACAGG - Intergenic
1146060985 17:29607329-29607351 TGGGACCCTTAGGGTAGGTCTGG + Intronic
1146292770 17:31622569-31622591 TGGTAACCTTGGGAACGAACAGG - Intergenic
1146314481 17:31796440-31796462 AGGGATTCTTGGGGAGGAACTGG - Intergenic
1146372036 17:32270682-32270704 TGGGACCCATGGGGAAGAATCGG - Intronic
1146735722 17:35237232-35237254 AGGTACCTTTGGGGAAGAGCTGG + Intergenic
1147248784 17:39139899-39139921 TGGGGCCCTTGCAGAATAACTGG - Intronic
1147881756 17:43658913-43658935 GGGGACCCTTAGGGAAGCCCAGG + Intronic
1151816997 17:76476265-76476287 CAGAGCCCTTGGGGAAGAACAGG - Intronic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155873743 18:31059078-31059100 TGGGTCCCTTGGGGCCCAACAGG - Exonic
1157341316 18:46780812-46780834 TGGGCCCATTGGGCAATAACAGG - Intergenic
1157995068 18:52545231-52545253 TGGGAACTGTGGGGAAGTACTGG + Intronic
1158027140 18:52913673-52913695 TGAGACTCTTGGGAAAAAACAGG - Intronic
1158217030 18:55111097-55111119 TGAGATGCTTGGGGAAGAAAAGG - Intergenic
1159711887 18:71770613-71770635 TTGAACCCTAGGGGAAGTACAGG - Intronic
1160507619 18:79436295-79436317 TGGGAGCCGTTGGGAACAACTGG + Intronic
1161345937 19:3768736-3768758 TCAGAACCTTGGGGAACAACAGG - Intergenic
1161412311 19:4123588-4123610 GGGGACCCTCGGGGGAGGACGGG - Intronic
1161520833 19:4722870-4722892 TGGGGCCCCTGGGGAAGACCAGG + Intronic
1161579234 19:5071597-5071619 GGGGACTCTTGGGAAAGAAGGGG + Intronic
1162312872 19:9917581-9917603 AGGGACCCTTGGGGAGGAACTGG - Intronic
1163188491 19:15658381-15658403 TGGCACCTTTGGGGATGACCCGG - Exonic
1163914846 19:20232044-20232066 TGTCACCCTTGGAGAAGACCTGG + Intergenic
1165454743 19:35903968-35903990 GGGGGCCCTTGGGGAAGCCCTGG + Intronic
1166231622 19:41428179-41428201 AGGGAGCCAAGGGGAAGAACAGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166523457 19:43496369-43496391 TGAGACCCTTGGGAAAAAATGGG - Intronic
1166812788 19:45524158-45524180 TGGGGCCCTTGGGGAGGTAAAGG + Intronic
1167559039 19:50214464-50214486 TGGGACCCTTGGGGCAGGGAGGG + Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
927483590 2:23473321-23473343 TGGGAGAGGTGGGGAAGAACAGG + Intronic
927836745 2:26404993-26405015 AGGCCCCTTTGGGGAAGAACTGG + Intronic
928022716 2:27716292-27716314 AGGGGCCCTTGGGGAGGAAAGGG - Intergenic
928309853 2:30200483-30200505 TGGGACCCTGGAGGACAAACTGG + Intergenic
928575822 2:32653999-32654021 TGGGACCCTTGGGGAAGAACTGG - Intronic
929554521 2:42917296-42917318 TGGGACTTTTTGGGCAGAACTGG + Intergenic
935761287 2:106322949-106322971 TGGGAGCCTTGGGGAGGGGCAGG + Intergenic
939260020 2:139795337-139795359 TGGGAACCATCAGGAAGAACGGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942597560 2:177606651-177606673 TGGGACCCATGTGGAGGAATGGG + Intergenic
943112930 2:183628691-183628713 TGGAACCCATGAGGATGAACTGG - Intergenic
944666117 2:201961119-201961141 TGGGTCCCTTGGGGATGAGCTGG + Intergenic
945132137 2:206584647-206584669 TGGGACCATCGGGTAAGGACAGG - Intronic
945250975 2:207766798-207766820 TGGGCCCCTTGGAGAAGACCTGG + Exonic
946168466 2:217879506-217879528 TGGGCCCCTGGGGGAGGAAAAGG + Intronic
948695489 2:239731220-239731242 TGAGACCCTTGAGGAAGGGCAGG - Intergenic
948741080 2:240046383-240046405 TGGGTCCCTTGGAGAAGTCCAGG - Intergenic
948758353 2:240172640-240172662 TGGGTGCCCTGTGGAAGAACAGG + Intergenic
1170847772 20:19976340-19976362 TGGTAACCTTGAGGGAGAACAGG - Intronic
1170987092 20:21268469-21268491 TGGGACAGCTGGGGAAGAGCAGG - Intergenic
1172538527 20:35693055-35693077 TGGGGTCCTTGGGGAAGGAGAGG + Intronic
1176064948 20:63189419-63189441 TGGGAGCCCTGGGCAAGAACAGG - Intergenic
1179902890 21:44402972-44402994 TGGGGCCCTGGGGGAGGCACCGG + Intronic
1183063703 22:35349999-35350021 TGGGAGCCTTGGGTAGGAGCAGG + Intergenic
1183160570 22:36110432-36110454 TGGGACCCTGGAGGAGGAAGGGG + Intergenic
1183361399 22:37385004-37385026 TGGGACCCTGGGGGAGGAGCAGG - Intronic
1183403268 22:37617132-37617154 TGGGACCCTTGGGGCAGGCCCGG - Intronic
1184077909 22:42195119-42195141 GGAGACCCTGGAGGAAGAACAGG + Intronic
950442217 3:13016649-13016671 TGAGGACCTTGGGGAAGAGCAGG - Intronic
951565014 3:24004445-24004467 TGAGGCCCTAGGGGAGGAACAGG + Intergenic
953617885 3:44508332-44508354 TGGGGCCCTATGGGAAGAACTGG - Intronic
954463471 3:50640817-50640839 TGGGGGATTTGGGGAAGAACAGG + Intronic
957156088 3:76546527-76546549 TGTGATCCTTAGGGAAGAAGAGG + Intronic
958142512 3:89580158-89580180 TGGTCCCTTTGGGGAAGAATGGG - Intergenic
958482846 3:94666199-94666221 TGGGACTCTTTGGGAAGGACAGG - Intergenic
961126109 3:124419478-124419500 TGAGAGCTTGGGGGAAGAACAGG - Intronic
961421684 3:126810841-126810863 TGGGACACAAGAGGAAGAACAGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961968753 3:130936237-130936259 TGGTAACCTTGGGGAAGATTTGG + Intronic
964223851 3:154374480-154374502 GGGGACCCTTGGGGAATATTAGG - Intronic
967184056 3:186930575-186930597 GGGGTCCGCTGGGGAAGAACGGG - Exonic
968106428 3:196004923-196004945 TTGGAGCCTTGGGGAGGAGCAGG - Intergenic
970022391 4:11583741-11583763 TGGAACTCTTGGGCAAGAGCTGG - Intergenic
970232438 4:13924797-13924819 TGGGGCCATAGGGGAAGAAGAGG + Intergenic
970238413 4:13982147-13982169 AGGGAGCCCTGGGGAGGAACAGG - Intergenic
970572230 4:17394117-17394139 TGGGACCCAGGGGCAAGAGCGGG + Intergenic
976600742 4:86935394-86935416 TGGGAGCCCTCGGGGAGAACGGG + Intronic
985873590 5:2578052-2578074 TGGTCCCCTTGTGGAAGTACGGG + Intergenic
985990834 5:3559703-3559725 TTGTACCATTTGGGAAGAACAGG + Intergenic
986037236 5:3951860-3951882 TGGTATCCTTGGGGAAGGATGGG + Intergenic
986493284 5:8315999-8316021 TGGGACCAGAGGGCAAGAACAGG - Intergenic
986541021 5:8843830-8843852 TGGGACACTTGGGAATGAAATGG - Intergenic
986720371 5:10556800-10556822 TGGGATCCTTGGGGAAGCCAGGG + Intergenic
987167972 5:15220705-15220727 TGGGTCCCTTGGGGAAGGACCGG + Intergenic
988529857 5:32017916-32017938 AGGGAACCTTGGGGAGTAACTGG + Intronic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
988919885 5:35930847-35930869 TGGGTCCCTTTGGCTAGAACTGG - Intronic
989695125 5:44191161-44191183 CAGGTCCCTTGAGGAAGAACTGG + Intergenic
991946252 5:71900926-71900948 TGGGCCCGTTGGGCAAGGACAGG - Intergenic
992013956 5:72557305-72557327 TGGGCCCCTGGAGGACGAACAGG - Intergenic
994186534 5:96821505-96821527 TGGGACCCAGGGGGAAGCACAGG + Intronic
995556634 5:113336507-113336529 TGGGACCATTGAGGACAAACTGG - Intronic
996706878 5:126506797-126506819 TGGGACAGCTGGGGAAGCACAGG - Intergenic
999280865 5:150364753-150364775 TGGGACCTTAGGAGAAGAAGGGG - Intronic
1000191772 5:158917944-158917966 TGGGTCCCTTTGGGAAGAAAGGG + Intronic
1001437292 5:171710054-171710076 TGAGAGCCTTGGGGATGACCTGG - Intergenic
1002985741 6:2189483-2189505 TGGGACTTTTGGGGGAGGACAGG - Intronic
1006909375 6:37554320-37554342 TGGGACCTCTGGGGAAGAGAAGG + Intergenic
1009851811 6:69208154-69208176 TGGGCCCATTGGGCAATAACAGG + Intronic
1010028353 6:71245641-71245663 TGGTACACTAGGGCAAGAACCGG - Intergenic
1011172570 6:84522202-84522224 TGGGCCCCTTGGGGAAGAAGGGG + Intergenic
1013010394 6:106115116-106115138 TGGCATACTTGGGGAAGCACGGG + Intergenic
1015105514 6:129531938-129531960 AGGGACCAGTGGGGAAGAAGGGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015450962 6:133365556-133365578 TGGGGCGCATGGGGAAGCACTGG + Intronic
1018206489 6:161441701-161441723 TGGGAACTGCGGGGAAGAACTGG - Intronic
1018301780 6:162410451-162410473 TGCCTCCCTTGGGGAAGAAGGGG + Intronic
1019572489 7:1719523-1719545 TGGGAGGCTTGGGGAACAACAGG - Intronic
1019764029 7:2836552-2836574 TGGGTCCTTTGGCCAAGAACAGG - Intronic
1020144793 7:5634196-5634218 TGTGACCATGGGGGAAGAACGGG + Intronic
1022327002 7:29341551-29341573 GAGGATCCTTGAGGAAGAACAGG + Intronic
1023319521 7:38978085-38978107 TGAGACCCTTGTGGAAAAAAGGG - Intronic
1023521943 7:41058216-41058238 TGGGACCTTTGGGAAAGGGCTGG - Intergenic
1029177903 7:98677950-98677972 TGGGACCCTTGGGCCAACACAGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1033114723 7:138615196-138615218 TGGGGCCTTTGGGGATGATCAGG + Intronic
1034075500 7:148227240-148227262 CGTGACCCTTGGGGAAGTAGAGG - Intronic
1034468220 7:151242248-151242270 AGGGACCATGGGGGCAGAACAGG + Intronic
1034761713 7:153678888-153678910 TGGGTCCATTGGGCAAGAAGTGG + Intergenic
1035236310 7:157499727-157499749 TGGGTCCCTAGGAGAAGCACAGG + Intergenic
1035642485 8:1194487-1194509 AGGGACCCCTGGGGATGACCTGG - Intergenic
1040436089 8:47393145-47393167 TGGGATACCTGGGGAAAAACTGG - Intronic
1044125937 8:88457791-88457813 TGGGACCCATGGGAAATAACTGG - Intergenic
1045676676 8:104615044-104615066 TGGGACTCCTGGGCCAGAACTGG + Intronic
1048430899 8:134369639-134369661 TGGGGTCCTTGGGGTAAAACAGG - Intergenic
1048683635 8:136875716-136875738 TGGTAGCCATGTGGAAGAACAGG + Intergenic
1049222681 8:141435094-141435116 TGGGATCGGTGGGGAGGAACAGG - Intergenic
1050718369 9:8555896-8555918 TTGCACCCTTGGGGAAGCATGGG + Intronic
1052276673 9:26684481-26684503 TGGGAGCCTTGAGGCAGAATTGG - Intergenic
1052982922 9:34461913-34461935 TGGGATCCCTGGGGATGAAGGGG + Intronic
1052998248 9:34563142-34563164 TGGGATCCTTGGAGGACAACCGG - Intronic
1056045524 9:82711581-82711603 ATGGACCCTTGTGGAAGCACTGG + Intergenic
1056117452 9:83454684-83454706 TGGGACCCCAGGAGAAGAAGGGG - Intronic
1057095224 9:92300963-92300985 TGGAACCCTGGGTGAGGAACAGG + Intronic
1057212779 9:93209793-93209815 TGGGATCCTGGGGGAAGGGCGGG - Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058541678 9:106018448-106018470 GGGAACCCTTGGGGAAGAGGAGG + Intergenic
1060826718 9:126692001-126692023 TGGGAACAGTGGGGAAGGACTGG + Intronic
1062723067 9:138054451-138054473 AGGGGCCCTTGGGGAAGAGCTGG + Intronic
1186057506 X:5665607-5665629 TGGGACTCTTGGGCAAAAGCGGG - Intergenic
1187243121 X:17531276-17531298 TGGGGCACCAGGGGAAGAACTGG - Intronic
1187936358 X:24340000-24340022 TGGGACCCAAGGTGAAGAAGAGG + Intergenic
1188027371 X:25224279-25224301 TGGGATCCTAGTGGAAGAAAAGG - Intergenic
1189648981 X:43168329-43168351 TGGGATTGTTGGGGTAGAACTGG + Intergenic
1190317807 X:49162949-49162971 TGGGGTCGTTGGGGAAGGACAGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1195764823 X:108285069-108285091 TGGGCCGCTTGGGAAAGAACAGG - Intronic
1198233183 X:134713130-134713152 TGGGACCTTTGGGGAACAGGGGG - Intronic
1199678676 X:150208976-150208998 TGGTACCATTGGGGAAAACCAGG - Intergenic
1201413850 Y:13728234-13728256 GGGGAACCTTGGGGAACAAAGGG - Intergenic