ID: 928581473

View in Genome Browser
Species Human (GRCh38)
Location 2:32712050-32712072
Sequence TAACCTTGCCCCAGTTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928581473 Original CRISPR TAACCTTGCCCCAGTTTGTC TGG Intronic
902391998 1:16112320-16112342 TAACCCTGCCCCAGGTGGACGGG + Intergenic
903995562 1:27303472-27303494 CAACCTTTCCCCAGTTTTCCAGG + Intronic
906687269 1:47770748-47770770 TGAACTTCCCCCAGTTTGACAGG - Intronic
916851156 1:168705413-168705435 CAACCTTGGCCCACTTTGTGGGG + Intronic
921966615 1:221097060-221097082 TCTCCTTTCCCCAGTTTCTCTGG + Intergenic
922343318 1:224674947-224674969 CACCCTTGCCCCACTTTTTCAGG + Intronic
924181799 1:241446277-241446299 AACCCCTGCCCCAGTGTGTCTGG + Intergenic
1067720440 10:48723872-48723894 TCACCATGCCTCAGTTTGTATGG - Intronic
1070918493 10:80169629-80169651 TAACCTTCACCCAGGTGGTCTGG - Intronic
1078005574 11:7529893-7529915 TAACCTTGCCCTGTTTTGTCAGG + Intronic
1086113268 11:83220749-83220771 TAAAGGTGCCCCAGTTTGTCTGG - Intronic
1087530623 11:99376576-99376598 TATCCTTGACCCACTTTATCAGG + Intronic
1092676437 12:10926354-10926376 TCACCTTGCTCTAGTTTGCCTGG - Intronic
1104245185 12:127033011-127033033 GAAACTTGTCCCAGGTTGTCTGG + Intergenic
1107871249 13:44748721-44748743 TAACTTTGCCTCAGTTCCTCAGG + Intergenic
1115019048 14:28652733-28652755 TGACCTTTCCCCATTTTGTAAGG + Intergenic
1119706812 14:76788261-76788283 TACCCTTGCCCCAGTTCTGCAGG + Exonic
1121407637 14:93728625-93728647 TGACCTTGACCCAGCATGTCTGG + Intronic
1122379367 14:101290702-101290724 TCACCGTGCTCCACTTTGTCAGG - Intergenic
1126341563 15:47646160-47646182 TAACCTTGCCTCAGTCTTTCTGG + Intronic
1134466889 16:14486850-14486872 TAACCTTTTCCAAATTTGTCAGG + Intronic
1134541860 16:15073580-15073602 TGACCTTGCCACAGTGTGTGAGG - Intronic
1139461717 16:67127899-67127921 TTACCTTCCCCCAGTGTTTCTGG - Intronic
1140658537 16:77165056-77165078 CAACCTTTCCCCAGTTTCTCTGG - Intergenic
1141269394 16:82525149-82525171 TAACTTTGGCCAAGTCTGTCTGG + Intergenic
1145078963 17:19878839-19878861 TCACCTTCCCCCAGTTTGCCTGG + Intergenic
1146876292 17:36414717-36414739 TAACCTTGCTGCTTTTTGTCAGG + Intronic
1147063091 17:37898156-37898178 TAACCTTGCTGCTTTTTGTCAGG - Intergenic
1147952383 17:44114396-44114418 CACCCATGCCCCAGTTTCTCTGG + Intronic
1148833091 17:50448886-50448908 TTACCTGGCTCCATTTTGTCAGG + Intronic
1151273386 17:73014242-73014264 TAACCTCGACCCAGCATGTCTGG + Intronic
1153969953 18:10217099-10217121 GAACTCTGCCCCAGTTTGTCTGG + Intergenic
1154929390 18:20976469-20976491 TAACACTGGCCCAGTATGTCAGG - Intronic
1159560209 18:69985354-69985376 AACCCTTGCCCTAGTATGTCTGG - Intergenic
1159929986 18:74300837-74300859 TAGCCTTCTCCCAGTTTGTGAGG + Intergenic
1162748483 19:12813128-12813150 TCGGCTTCCCCCAGTTTGTCCGG + Exonic
1163216895 19:15885749-15885771 TAACCTTTCCCCAGACAGTCAGG + Intronic
1164612919 19:29645259-29645281 TACCCTTCTGCCAGTTTGTCAGG + Intergenic
1166395006 19:42433260-42433282 AAACCTTGCCCAAAGTTGTCAGG - Intronic
1167488994 19:49781169-49781191 CAACCTCTCCCCAATTTGTCTGG - Intronic
927905952 2:26857137-26857159 TAATCTTGCCCAAGGCTGTCAGG - Intronic
928326479 2:30323362-30323384 TAAACTTGCCCCAGATTGATAGG + Intronic
928435748 2:31253527-31253549 TAACCATGCCCCTTTTTATCTGG - Intronic
928581473 2:32712050-32712072 TAACCTTGCCCCAGTTTGTCTGG + Intronic
934028370 2:88019103-88019125 TTAACATGCCCCTGTTTGTCAGG - Intergenic
935220428 2:101007674-101007696 TCCCCTGGCCACAGTTTGTCAGG + Exonic
939130950 2:138235795-138235817 TAACTTTGCCCCATATTGCCAGG - Intergenic
941868841 2:170362417-170362439 CAACCTTGCCCCAGGATCTCTGG + Intronic
1169306061 20:4491498-4491520 TAAGCCTTTCCCAGTTTGTCTGG - Intergenic
1170751727 20:19154283-19154305 TAACCTAGCCCAAATTTGTGGGG + Intergenic
1171849552 20:30298351-30298373 CAACCTTGCTCCAGTGTGTAGGG + Intergenic
1172562730 20:35903934-35903956 AAGCCTTGCCCCAGTTTGTCAGG + Intronic
1174821553 20:53730782-53730804 CCAGCTTGTCCCAGTTTGTCTGG + Intergenic
1176000709 20:62830143-62830165 TACCCTGGACCCAATTTGTCAGG - Intronic
1181643076 22:24214997-24215019 TAACTTTGTCCCTGTGTGTCGGG - Intergenic
1183192990 22:36333764-36333786 GAACTGTGTCCCAGTTTGTCAGG - Intronic
1184013401 22:41766865-41766887 TCACGTTGCCCTAGTTTATCAGG + Intronic
949920984 3:9000309-9000331 CAACCTTGCCCCAGCTTGTGAGG + Intronic
957392725 3:79598715-79598737 TAAGCTTGCCCCAGAATCTCAGG - Intronic
959158495 3:102695729-102695751 TAACCTTCTGCCAGCTTGTCAGG + Intergenic
960913649 3:122675295-122675317 TAACCTTGCACATGTTTGTTTGG - Intergenic
964549503 3:157871057-157871079 CCAACTTGTCCCAGTTTGTCTGG - Intergenic
967398992 3:189040083-189040105 TAACCTGGCCCTAGGGTGTCAGG - Intronic
977643037 4:99378760-99378782 TGACATTGCCCAAGGTTGTCAGG + Intergenic
979077629 4:116294205-116294227 TAACCTTGTTCCATTTTGTGCGG + Intergenic
980397339 4:132231641-132231663 TAACACTGCCACAGTTTGTGAGG + Intergenic
986609584 5:9553178-9553200 AACCCTTGCCCCAGTGTGTACGG - Intergenic
989754888 5:44940388-44940410 TAAACTTGCCTCAGTGTGTGGGG - Intergenic
991021069 5:61980724-61980746 TGACCTCACCCCAGTTTGTAGGG + Intergenic
993482984 5:88448154-88448176 TCACCTTGGCCCAGGTTGTCAGG + Intergenic
993742737 5:91560693-91560715 TAACCTTTCCCCACTTTTTGAGG - Intergenic
996450065 5:123610905-123610927 TAACTTTGTGCCAGTTTGTTGGG + Intronic
997263147 5:132478839-132478861 TAACCTTTCCCCAGTTCTGCTGG - Intergenic
1001459037 5:171892625-171892647 TAAACTTGTCCCAGTGTCTCAGG - Intronic
1007072347 6:39047101-39047123 TAACCTTGCCCATGGTTGCCTGG + Intergenic
1010472812 6:76249974-76249996 TAACCTTTCCCCACCTTCTCTGG - Intergenic
1014189297 6:118474538-118474560 GACCCTTGCCCCAGCTTGTGGGG + Intronic
1014710215 6:124797725-124797747 TATCATTTCTCCAGTTTGTCAGG + Intronic
1015116466 6:129654925-129654947 TACCCATGCCCCTGCTTGTCAGG + Intronic
1023389616 7:39696912-39696934 TAACTTGGCTCCATTTTGTCTGG + Intronic
1028405440 7:90468974-90468996 CAATCTTGCCCCAGTATGTGTGG - Intronic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1035966421 8:4197128-4197150 TAACCTTGTTGTAGTTTGTCTGG - Intronic
1043329994 8:79103848-79103870 AAACCTTTCCCCTGTTTTTCTGG - Intergenic
1045682093 8:104672888-104672910 TAGACTTGTCACAGTTTGTCTGG - Intronic
1047898245 8:129390959-129390981 TAACCATGCCTCAGATTGGCAGG + Intergenic
1056882117 9:90405177-90405199 CCATCTTGCCCCACTTTGTCAGG + Intergenic
1057969927 9:99545138-99545160 AACCCCTGCCCCAGTGTGTCTGG - Intergenic
1058349107 9:103999838-103999860 TAACCTTCCACCCGTTTTTCGGG - Intergenic
1060588377 9:124800896-124800918 CAACCCTGTCCCAGTTTGCCTGG + Intronic
1187921000 X:24201689-24201711 TAACCTTGGCCCAGTTAGCCGGG + Intronic
1189629085 X:42932632-42932654 AAAACATGCCCCAGTTTGTCAGG - Intergenic
1189750137 X:44212437-44212459 TACCCTTACCCCAGGTTGTTAGG - Intronic
1191692664 X:63957096-63957118 TCACCTTGCCCCAGTTCTTACGG - Intergenic
1195563541 X:106314378-106314400 TATCCTTTTCTCAGTTTGTCAGG - Intergenic
1197491780 X:127126358-127126380 AAACATTTCCCCAGTTTATCAGG + Intergenic