ID: 928586237

View in Genome Browser
Species Human (GRCh38)
Location 2:32761294-32761316
Sequence GGTAAGAAGCAGTCTGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 8, 3: 45, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928586237_928586238 -6 Left 928586237 2:32761294-32761316 CCAGAATCAGACTGCTTCTTACC 0: 1
1: 0
2: 8
3: 45
4: 239
Right 928586238 2:32761311-32761333 CTTACCACCTCCTGTCATCCTGG 0: 1
1: 0
2: 0
3: 20
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928586237 Original CRISPR GGTAAGAAGCAGTCTGATTC TGG (reversed) Intronic
901693186 1:10987526-10987548 AGAAAGAAGCAGCATGATTCAGG + Intergenic
902475572 1:16683200-16683222 GGTAAGAAGCAGTCTCTTTAGGG + Intergenic
905445418 1:38025623-38025645 ACTAAGCAGCAGTCTGATCCTGG + Intergenic
906902774 1:49854581-49854603 GGTAAGAGGTAGTCTGATGGGGG - Intronic
907816310 1:57921609-57921631 GGCAAGAAGTGATCTGATTCTGG - Intronic
907877293 1:58503957-58503979 GGAAAGAATCAGTCAGATTCTGG - Intronic
908206234 1:61852729-61852751 GATGAGAAGCAGCCTGAGTCAGG + Intronic
908600638 1:65735585-65735607 AGTGAGAAGCAGTCAGACTCTGG - Intergenic
908774362 1:67625943-67625965 GGTGAGAAGCAGTTGAATTCCGG - Intergenic
910102724 1:83595874-83595896 AGTGAGAAGCAGTCTAATTCTGG + Intergenic
911933305 1:103932783-103932805 GGTGAGAAACAGTCAGATTGTGG + Intergenic
912788624 1:112628886-112628908 GGTAAGAAATAGTCAAATTCTGG - Intronic
914008140 1:143751402-143751424 GGTTTGAAGCAGTTTGATTAAGG + Intergenic
916167275 1:161975404-161975426 GGCAAGAAGCAGGCTGGCTCTGG - Intergenic
916471127 1:165123780-165123802 GGAAAGAAGGAGAATGATTCAGG + Intergenic
917184002 1:172331942-172331964 AGTGAGAAGCAGTTGGATTCAGG + Intronic
917805683 1:178611408-178611430 GGTAAGAAGTAGTCTGGGCCAGG + Intergenic
918182194 1:182094014-182094036 TCTAACAAGCAGTCAGATTCTGG + Intergenic
919550111 1:198975213-198975235 GGAAGGAAGGAGTTTGATTCTGG + Intergenic
920919666 1:210288074-210288096 GATAAGAAGTAGTCTGATTTGGG + Intergenic
921835522 1:219774304-219774326 GGCAAGAAGCAATGTGATCCAGG + Intronic
924790573 1:247243805-247243827 GGTAAGAAGCAGTCTCAAAAGGG + Intergenic
924836465 1:247652986-247653008 GGTGAGAAGCGGCCGGATTCTGG + Intergenic
1063601155 10:7482670-7482692 GAGAAGAAGCAGCCTGAGTCTGG - Intergenic
1063802977 10:9602712-9602734 GGTGAGAAGTAGTAAGATTCAGG + Intergenic
1065804621 10:29383115-29383137 GGTGAGAAGTGGTCTGACTCTGG + Intergenic
1067509847 10:46885545-46885567 GTTAAGAAGCAGCCAGATTTGGG + Intergenic
1067652407 10:48166313-48166335 GTTAAGAAGCAGCCAGATTTGGG - Intronic
1067679189 10:48416917-48416939 GGTAAGAAGCAGGCTGAGAAAGG - Intronic
1068921527 10:62489627-62489649 GGTGGGAAGCAGTCAGATTCTGG + Intronic
1069109169 10:64423547-64423569 GGTAATTGGCAGTCTGATTAAGG - Intergenic
1069480467 10:68777155-68777177 CGTAAGAAGTGGACTGATTCTGG - Intronic
1070659733 10:78295963-78295985 GGTGAGAGGCAGTCAGATTCTGG - Intergenic
1071534895 10:86420356-86420378 GGTGAGAGGTAGTCAGATTCTGG + Intergenic
1071845099 10:89513885-89513907 GGAAAAAAGAAGTCAGATTCTGG + Intronic
1076582140 10:131518807-131518829 GGTAAGAAGATGTCAGATGCTGG - Intergenic
1078366456 11:10710641-10710663 GGTAAGAAATGGTCAGATTCTGG - Intergenic
1078675480 11:13408748-13408770 ATTAAGAAGTAGTCAGATTCTGG - Intronic
1078877883 11:15416319-15416341 TGTAATAAGAAATCTGATTCTGG + Intergenic
1079260155 11:18870927-18870949 GGCAAGGAGGAGTCTGTTTCAGG + Intergenic
1079287707 11:19153934-19153956 GGTAAGAAGGGGTCAGATTCTGG - Intronic
1079519492 11:21309158-21309180 CATAACAAGCAGTTTGATTCAGG + Intronic
1080219644 11:29886489-29886511 GGTAAGAAGTGTTTTGATTCTGG - Intergenic
1080926316 11:36760202-36760224 GGTGAGAAGTTGTCTTATTCTGG + Intergenic
1081067102 11:38557381-38557403 GGTAAAAAGCAGTCTGAGTCTGG + Intergenic
1081152815 11:39652712-39652734 GGCAGGAAGCAGACAGATTCTGG - Intergenic
1082270041 11:50160496-50160518 GGTGAGAAGCAGTCAGATTCTGG + Intergenic
1082934373 11:58641054-58641076 GGTAGGAGGCGGTCTGAGTCTGG - Intronic
1084582406 11:70032248-70032270 GGAGAGAAGCAGTCTCATTGTGG + Intergenic
1085282806 11:75341946-75341968 CGTGAGCAGCAGTGTGATTCTGG - Intronic
1085933424 11:81114144-81114166 GGCAAAAAGCAGGCAGATTCTGG - Intergenic
1087050484 11:93881947-93881969 GGTAAGAAGGAGTTTGTTTTGGG - Intergenic
1087376541 11:97349635-97349657 AGAAAGAAGCAGCATGATTCAGG + Intergenic
1088516944 11:110647089-110647111 AGTAAGAAGCAGTTTTATTCTGG + Intronic
1089708192 11:120295915-120295937 GGTAAGAAGATGGCTGTTTCAGG - Intronic
1089733365 11:120533435-120533457 GGGCACAGGCAGTCTGATTCAGG + Intronic
1089880609 11:121769816-121769838 GGTGAGAAGGGGTCAGATTCTGG - Intergenic
1090645092 11:128760854-128760876 GGTAAGGAGTAGGCAGATTCAGG - Intronic
1090853417 11:130590561-130590583 GGTAAGATGCTGTCTCATTATGG + Intergenic
1091002560 11:131922597-131922619 GGTAAAAAGTGGTCTGATTCAGG - Intronic
1093073743 12:14735542-14735564 GGTGAGAAGCAGTTGGATTCTGG - Intergenic
1093464017 12:19432313-19432335 GGGCACAAGCAGTCTGCTTCGGG + Intronic
1093704343 12:22258014-22258036 AGTGAGAAGCAGCCAGATTCTGG - Intronic
1094068707 12:26389036-26389058 GGTGAGAAGTGGTCAGATTCTGG - Intronic
1094626906 12:32132925-32132947 GGTAAGAAGTGATCTGATTCAGG + Intronic
1094766038 12:33595718-33595740 GGTGAGAAGCATTCAGATTTTGG + Intergenic
1095928447 12:47603045-47603067 AGAAAGAAGCAGTGTGGTTCTGG + Intergenic
1097903445 12:64896375-64896397 GGTAAGAAGTGGTCAGATTCTGG + Intergenic
1098605967 12:72389947-72389969 GGTAAGAAGGGGGCAGATTCTGG + Intronic
1099166704 12:79315695-79315717 GGTAATAAGGAGTGTGATTTTGG - Intronic
1100087075 12:90924400-90924422 GGTGAGAAGTAGTTAGATTCTGG + Intronic
1100662383 12:96714203-96714225 GGTGAGAAGTAGCCAGATTCTGG + Intronic
1101669184 12:106851058-106851080 GGTAAAAATCAGTATGACTCGGG + Intronic
1101750401 12:107578781-107578803 CCTAAGAAGCAGGCTGATTCAGG + Intronic
1102449112 12:113027341-113027363 GGCGAGAAGCAGTCTGGTTTTGG - Intergenic
1103176829 12:118871637-118871659 GGTGAGAACCGGTCAGATTCTGG - Intergenic
1104223645 12:126810503-126810525 GGTGAGAAGAGCTCTGATTCTGG + Intergenic
1107175252 13:37392208-37392230 GGGAAGAAGCTGTTGGATTCTGG + Intergenic
1107619392 13:42210632-42210654 GATAAGCAGAAGTGTGATTCTGG + Exonic
1108076809 13:46689131-46689153 AGCAAGAAGGATTCTGATTCGGG + Exonic
1108469982 13:50757869-50757891 AGAGAGAAGCACTCTGATTCAGG + Intronic
1109727752 13:66366440-66366462 GGAAAGATGGAGTCTGATTTAGG - Intronic
1110282956 13:73716880-73716902 TTTAAGAAGCATTCTGATTTTGG - Intronic
1110825036 13:79961964-79961986 GCTATGAATCAGTCTGATCCTGG - Intergenic
1112347353 13:98601398-98601420 GGTGAGAAGGTGTCAGATTCTGG - Intergenic
1113949625 13:114064783-114064805 GGTCAGCAGCAGTCAGATGCGGG + Intronic
1114881754 14:26795046-26795068 TCTGAGAAGCAGTTTGATTCTGG + Intergenic
1116007353 14:39309102-39309124 GGTAAAAAGTGGTCAGATTCAGG - Intronic
1120212892 14:81651642-81651664 GGGAAGCAGCAGACTGATTCTGG - Intergenic
1120355340 14:83426517-83426539 GGTAAGAAGGAGTTTGATGGTGG - Intergenic
1121752178 14:96366065-96366087 AGTTAGAAGCAGTTGGATTCTGG + Intronic
1125902740 15:43364068-43364090 GGCAAGAAGCAGTCTCTTCCTGG + Exonic
1126040672 15:44587319-44587341 GCTGGGCAGCAGTCTGATTCAGG + Intronic
1126724246 15:51614995-51615017 GATAAGAAGTAATCAGATTCTGG + Intronic
1126928053 15:53612948-53612970 GGTGAGAAGCAGTCAGATTCTGG + Intronic
1126988666 15:54344803-54344825 GGTGAAAAGTGGTCTGATTCTGG - Intronic
1129636945 15:77330264-77330286 GATGAGAAGTAGTTTGATTCTGG - Intronic
1130446721 15:84008981-84009003 GGTAAGAGACGGTCAGATTCTGG - Intronic
1131482937 15:92797660-92797682 AGGAAGAAGCAGCCTGATGCGGG + Intronic
1140058782 16:71549240-71549262 GGTGAGAAGTGGTCTGATTCAGG - Intronic
1140151756 16:72374521-72374543 GGTAAGAAGTAGAGGGATTCAGG + Intergenic
1144929701 17:18849396-18849418 GGTAAGAAGCAATGTGATGCTGG + Intronic
1145284738 17:21496892-21496914 GGTAAGAAGCAGCATGATTTTGG + Intergenic
1145392782 17:22468871-22468893 GGTAAGAAGCAGCATGATTTTGG - Intergenic
1146210360 17:30937663-30937685 GGTTAGAAGTGGTCAGATTCTGG + Intronic
1146677248 17:34781975-34781997 GGGAAGAAGCAGCATGCTTCAGG + Intergenic
1148810862 17:50290223-50290245 AGCAAGGACCAGTCTGATTCAGG - Intergenic
1149681408 17:58509972-58509994 GGTGAGAAGCATTCAGATTCTGG - Intronic
1150145386 17:62764938-62764960 AGTCAGCAGCAGTTTGATTCAGG - Intronic
1150322974 17:64231970-64231992 GGAAACAAGCTGTCTGATCCCGG - Intronic
1155311987 18:24532943-24532965 GACAAGCAGCAGTCTAATTCGGG + Intergenic
1155748683 18:29392140-29392162 GCTAATAAGCAGTGTGAGTCTGG - Intergenic
1156492389 18:37503941-37503963 AGTAAGAAGCAACCAGATTCAGG + Intronic
1156833227 18:41521006-41521028 GGTAGGAAGCACTCTGATATTGG + Intergenic
1157233423 18:45940540-45940562 GGTAAGAAGCAGCTAGATTCTGG + Intronic
1159626442 18:70700693-70700715 GGTAAGATGATGTCTTATTCTGG + Intergenic
1161647414 19:5462046-5462068 CAAAAGAAGCAGTCTGATTTCGG - Intergenic
1162400771 19:10445275-10445297 GGTGAGAAGTAGACAGATTCTGG + Intronic
1162773554 19:12965212-12965234 GGTGAGAAGCGGGCGGATTCTGG + Intronic
1163891991 19:20025035-20025057 GTTAAAATGCAGTCTGATCCAGG + Intronic
1165263295 19:34638983-34639005 TGTAAGATGCTGTCTGCTTCTGG - Intronic
1167414565 19:49363254-49363276 GGGAAAAGGAAGTCTGATTCTGG + Intronic
1167555622 19:50193356-50193378 GGCAAGAAGGGGTCGGATTCTGG + Intronic
1167704320 19:51069867-51069889 GGTAAGAAACAGTCAGATTCTGG - Intergenic
925926816 2:8676891-8676913 ATTAAGATGCAGTTTGATTCCGG + Intergenic
927022479 2:19031570-19031592 GGAGAGAAGCAGGCTGCTTCGGG - Intergenic
927153754 2:20210321-20210343 GGGAAGAAACAGTCTGGTCCTGG + Intronic
928586237 2:32761294-32761316 GGTAAGAAGCAGTCTGATTCTGG - Intronic
928866885 2:35927812-35927834 GATGAGAAGGAGTCAGATTCAGG - Intergenic
931458188 2:62428320-62428342 CCTAAGAAGCACCCTGATTCTGG - Intergenic
934883012 2:97999571-97999593 GGTGAGAAGCAGTTAGATTTGGG - Intergenic
936037518 2:109124762-109124784 GGCAAGAAGAAATCTGATACAGG - Intergenic
936175410 2:110215655-110215677 GGTAAGAAGCGATTTCATTCTGG - Intergenic
936916596 2:117645600-117645622 TGTAAAAAGCATTCTGATGCAGG + Intergenic
936982781 2:118279450-118279472 GGGTAGGAGGAGTCTGATTCAGG + Intergenic
937071275 2:119065597-119065619 GGTGAGAAGCACTCGGATGCTGG - Intergenic
939128012 2:138201422-138201444 GATATCAAGCAGTCTGATTTAGG - Intergenic
940451956 2:153849835-153849857 GCTAAGAAACTATCTGATTCTGG + Intergenic
942619132 2:177829028-177829050 GGTAAGAAGTGGTCAGATTCTGG + Intronic
944192452 2:197018074-197018096 GGTGAGAAGAAGACAGATTCTGG - Intronic
944646765 2:201787903-201787925 GGTAAAAAGCGGTTTGGTTCTGG + Intergenic
945461096 2:210109750-210109772 AGAAAGAAGCAGGCTGATTCAGG - Intronic
945826594 2:214727821-214727843 ATTAAGAAGCAGTCTTCTTCTGG - Exonic
946730246 2:222702735-222702757 GGAAAAAAGCAGACTGAATCTGG + Intronic
1170976884 20:21173242-21173264 GGTAAGAAGTGGTCAGATTCTGG + Intronic
1171066676 20:22023602-22023624 GCTGTGAAGCAGTCTGGTTCTGG + Intergenic
1172108897 20:32533903-32533925 GGCAAGATTCAGTCCGATTCAGG - Intronic
1173849594 20:46209644-46209666 GGTGAGAAGTGGTCAGATTCTGG + Intronic
1177550843 21:22620201-22620223 GGTGAGAAGCAGTAGGATTCTGG + Intergenic
1178334213 21:31729939-31729961 GATCAGAAGTATTCTGATTCAGG - Intronic
1178507660 21:33176211-33176233 TGTGAGAAGCAGTCATATTCTGG - Intergenic
1179238612 21:39568824-39568846 AGGAAGAGGCAGTCAGATTCTGG - Intronic
1182680172 22:32073441-32073463 GGGCAGAAGCAGTGTGAGTCAGG - Intronic
1183457606 22:37931109-37931131 GGTGAGAATCTGTCTGTTTCAGG - Intronic
1184636331 22:45834995-45835017 GGTACGAAGCAGTCACAGTCTGG - Intronic
950171999 3:10845170-10845192 GGTAAAAAGAAATCTGATTCTGG + Intronic
950260753 3:11542189-11542211 GGTTAGAAGCAGACTGGTTTTGG - Intronic
950916098 3:16646736-16646758 GGTGAGAAGCAGGCAGAGTCTGG + Intronic
951345069 3:21537984-21538006 GGTGAGAAGCAGTCAGATTCTGG + Intronic
951593643 3:24293849-24293871 GGTAAGAAAGAGTCTGAGTAGGG - Intronic
952770704 3:36997473-36997495 TGTAAGAAGCAGTGAGATTCTGG + Intronic
952909910 3:38174686-38174708 GGTGAGAAGTGGTCAGATTCTGG + Intronic
953932745 3:47013921-47013943 GGCAAGAAGCAGGCTGGTCCTGG + Intergenic
954360052 3:50117143-50117165 CGCAAGAAGCAGTTTGATGCCGG + Exonic
954404744 3:50339285-50339307 GATAAGAAGCAGGATGATTTGGG - Intronic
955955172 3:64281316-64281338 GGTAAGAACCTATCTGTTTCAGG - Intronic
956235917 3:67070733-67070755 GATGAGAAGTAGTCTGACTCTGG - Intergenic
956488045 3:69742028-69742050 GGTAAGAAGCGGGCAGATTCTGG - Intronic
956910997 3:73816846-73816868 GGTGAGAAGCAGTCAGATTCTGG + Intergenic
957494202 3:80969577-80969599 GGCAAGATGCAGTCTCATGCGGG + Intergenic
958193825 3:90217612-90217634 GGTAAGAAGTGGTCAGATTCTGG - Intergenic
958417181 3:93888661-93888683 GGTAAGAAGTGGTCAGATTCTGG - Intronic
958809210 3:98840248-98840270 GTTAAGATGTAGTCAGATTCTGG + Intronic
958986162 3:100781924-100781946 GCTAGGAAGCAGTGGGATTCAGG + Intronic
959301370 3:104606425-104606447 GCTAAGAAACAGTATGATTAAGG + Intergenic
960384137 3:117000346-117000368 GGTCAGAAGCTGTCTGAGGCAGG + Intronic
960430590 3:117563875-117563897 GGTGAGAAACAGTCAGATGCTGG + Intergenic
960676280 3:120198485-120198507 GGTGAGAAGGAGTTAGATTCTGG - Intronic
960990675 3:123309110-123309132 GGTAAGGAACAGTTTGATCCTGG + Intronic
961513322 3:127417871-127417893 GGTATGAAGCAGGCTGCCTCTGG + Intergenic
962486183 3:135844887-135844909 GGTAAGAAGTTGTCAGATACTGG + Intergenic
964359853 3:155883926-155883948 GGAAACAAGCAGGTTGATTCGGG + Intronic
964386848 3:156156513-156156535 GGTGAGAAGTAGTTGGATTCTGG + Intronic
964765024 3:160171280-160171302 GGGAAGGGACAGTCTGATTCTGG + Intergenic
965043164 3:163536831-163536853 GATAAGAAGCAGGCAGATGCAGG - Intergenic
965660568 3:171037606-171037628 GGTAAGATGTGGTCAGATTCAGG - Intergenic
965800212 3:172484688-172484710 GGTGAGAAACAGTCTAAATCTGG + Intergenic
966244366 3:177790235-177790257 AGAAAAAAGCAGTCTGTTTCAGG + Intergenic
967354714 3:188555495-188555517 GATAAGAAGTAGTGGGATTCTGG + Intronic
970546042 4:17131508-17131530 GGTGAGAAGCAGTCAGATTCTGG - Intergenic
970970242 4:21974821-21974843 GGTCAGAAGAAGTATGTTTCTGG - Intergenic
971484684 4:27147210-27147232 AGAGAGAAGCAGTCTGTTTCAGG - Intergenic
971489392 4:27195119-27195141 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
971703778 4:30013272-30013294 GGTAGGATGCAGTCTGATGATGG + Intergenic
972480100 4:39488601-39488623 AGTTAGAAGCAGTCTAAATCTGG - Intergenic
974133611 4:57787477-57787499 GGTAAGAAGTGGTCAGATTTGGG + Intergenic
974356175 4:60815640-60815662 GGTAAGAAGTGGTTAGATTCTGG - Intergenic
975197683 4:71544554-71544576 GGTAAGAAGCGGTTGGGTTCTGG - Intronic
975849753 4:78560077-78560099 GGTCAGAAGGAATCTGATTGAGG - Intronic
976221539 4:82760311-82760333 GGAAAGGAGCAGACTTATTCAGG - Intronic
978599696 4:110414951-110414973 GGTGATAAGGATTCTGATTCTGG - Intronic
981084517 4:140669275-140669297 GGTAAGTAGGATTCTGACTCTGG - Intronic
981652245 4:147073258-147073280 AGTGAGAAGTAGTCAGATTCAGG + Intergenic
981831015 4:149001938-149001960 GGTAAGAAGTGGTCAGATTCTGG - Intergenic
984043351 4:174765709-174765731 GGTTAGAAACAGTCTGGTTCTGG - Intronic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984793433 4:183635366-183635388 GGTGAGAAGCGGTCAGTTTCTGG - Intergenic
985183496 4:187291122-187291144 GGTAAGAACAAGTGTGATTTCGG - Intergenic
985895904 5:2749932-2749954 GGAAAAACGCAGTGTGATTCGGG + Intronic
987236806 5:15950770-15950792 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
987903590 5:24047490-24047512 GGTAAAATGTAGTCAGATTCTGG - Intronic
988581420 5:32472168-32472190 GGTAAGACGTAGTCAGATTTTGG - Intergenic
988906703 5:35798055-35798077 GGGAAGAAGTGGTCTCATTCGGG - Intronic
994840349 5:104916317-104916339 GCTAATAATCAATCTGATTCTGG - Intergenic
996248543 5:121297066-121297088 GGTATTAAGCAGGCTCATTCTGG + Intergenic
996411275 5:123161973-123161995 GGTGAGAAGTAGTTGGATTCTGG + Intronic
996570189 5:124925192-124925214 GTTAAGAAGTAGTCAGATTCTGG + Intergenic
996599360 5:125243998-125244020 GCTATGAATCCGTCTGATTCTGG + Intergenic
997021157 5:130003206-130003228 GGTAGGAAGCATTATTATTCAGG + Intronic
998689902 5:144575940-144575962 GGTAAGAAGCAGGCTGTTTCAGG + Intergenic
1000100290 5:158009740-158009762 GGTGAGAAGTAGTCAGATTCTGG - Intergenic
1000288629 5:159849224-159849246 GGTAAAATGCAATCTGATTCAGG + Intergenic
1002537431 5:179885003-179885025 TGTAAGAAGGGGTCAGATTCAGG - Intronic
1003705971 6:8530171-8530193 GGTAAGAAGCAGCCTTTTTTGGG + Intergenic
1005438247 6:25837696-25837718 GGTAAGATGCAGGTTTATTCTGG + Intronic
1007251172 6:40496176-40496198 GGTAAGAAGGGGTTGGATTCGGG - Intronic
1007381275 6:41491751-41491773 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
1008302340 6:49856408-49856430 GGAAGGAAGAAGTCTTATTCAGG + Intronic
1008673472 6:53795731-53795753 GGTGAGAAGCCGGGTGATTCGGG + Intronic
1010510816 6:76717087-76717109 GGTAATAAGTAGTCATATTCTGG - Intergenic
1011465074 6:87646991-87647013 GGCAAGAAGAGGTCTGATTCTGG - Intronic
1011572034 6:88748044-88748066 GGTGAGAAACAGTCAGATTCTGG - Intronic
1011587592 6:88943424-88943446 GGTGAGAAGTGGTCAGATTCTGG - Intronic
1011600859 6:89058871-89058893 GGTAAGAAGCAGTCTCCATATGG - Intergenic
1012706393 6:102537358-102537380 GGTAAAAAGAAGTATGATTGAGG - Intergenic
1013091470 6:106904548-106904570 GGTGAGAAGTGGTCAGATTCTGG - Intergenic
1013772760 6:113645892-113645914 GCTCACAAGCATTCTGATTCAGG + Intergenic
1014743170 6:125169624-125169646 GGTAGGAAGCTGTCCCATTCTGG - Intronic
1015300210 6:131644437-131644459 GGTAAGAAGTATTTGGATTCTGG + Intronic
1016862469 6:148734644-148734666 GGTGAGAAGTAGTCTGATTTGGG - Intergenic
1019062147 6:169264124-169264146 GGTGAGCACCAGTCAGATTCTGG - Intergenic
1020405635 7:7830595-7830617 GGTAAGAATCAGTATGACTGTGG - Intronic
1023759717 7:43453284-43453306 GGTGAGGAGTGGTCTGATTCTGG + Intronic
1026114212 7:67482765-67482787 GGTAAGAAACAGCTGGATTCAGG - Intergenic
1027632703 7:80627138-80627160 TGAAAGAATCAGTCTGACTCAGG + Intronic
1027679894 7:81206834-81206856 GATAAGAAGCTATCTCATTCAGG - Intergenic
1029908520 7:104118899-104118921 GGTGAGAAGTTGTCAGATTCTGG - Intergenic
1030501291 7:110363489-110363511 GGTAAGAAGCAGTGTAATTATGG + Intergenic
1031454826 7:121966032-121966054 GATAAGAAGAGGTCTGATTAGGG + Intronic
1031624800 7:123980058-123980080 GGTGAGAAGTGGTCAGATTCTGG - Intergenic
1033885722 7:145942759-145942781 GTTAAGATGCAGTCTGATGGTGG - Intergenic
1033992370 7:147304406-147304428 GGTAATAAGCTTTCTGATACAGG + Intronic
1034840404 7:154390572-154390594 GGTAAGAAGCAATCATTTTCAGG + Intronic
1036615927 8:10387570-10387592 GCTAAGAAGAACTCTGACTCAGG - Intronic
1037127581 8:15369522-15369544 GGTAATAAGCAGAATGTTTCTGG - Intergenic
1037218739 8:16490161-16490183 AGTGAGAAGCAGTTGGATTCTGG - Intronic
1037363212 8:18095778-18095800 GGTGAGAAGTGGTCAGATTCGGG - Intergenic
1037551084 8:19972127-19972149 GGTAAAATGCAGTCAGATTCTGG - Intergenic
1040893634 8:52342632-52342654 TGCAAGAAGCACTCTGATGCAGG + Intronic
1041848669 8:62361076-62361098 GGTGATAAGCAGTGTGATGCGGG - Intronic
1043048254 8:75354209-75354231 AGAAAGAAGCAGTCTCTTTCAGG + Intergenic
1044211842 8:89559989-89560011 GGTGAGAAGTGGTCAGATTCTGG - Intergenic
1044267011 8:90193828-90193850 GGTATGAAGGAGTCTGCTTTTGG - Intergenic
1044533486 8:93334305-93334327 GGGAAGGAGCATTCTGATTATGG + Intergenic
1045159846 8:99526489-99526511 GGTGAGAAGTGGTCAGATTCTGG + Intronic
1045686715 8:104720209-104720231 GGCAAGAAGTGGTTTGATTCTGG + Intronic
1053376304 9:37609539-37609561 AGTGAGAAGTACTCTGATTCTGG - Intronic
1053536099 9:38927874-38927896 AGTCAGAAGTGGTCTGATTCAGG - Intergenic
1054630037 9:67436078-67436100 AGTCAGAAGTGGTCTGATTCAGG + Intergenic
1055505559 9:76944823-76944845 GTTGAGAAGCAGTCAGATTCTGG - Intergenic
1055988321 9:82077435-82077457 TGTAAGAGGCATTGTGATTCAGG + Intergenic
1057457739 9:95229417-95229439 GGTAGGAAGTGGTCAGATTCTGG + Intronic
1058047473 9:100372101-100372123 AGAAAGAAGCAGTCTGAGTGAGG - Intergenic
1058408126 9:104700228-104700250 TGTAAAAAGCAGACAGATTCAGG + Intergenic
1058662000 9:107275098-107275120 GGTAAGAAGCGGTTGGGTTCTGG - Intergenic
1061069880 9:128302796-128302818 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
1186974652 X:14888683-14888705 GGTAAGAAGGTGTATTATTCAGG - Intronic
1187498156 X:19814212-19814234 GGTGAGAAGTGGTCAGATTCTGG - Intronic
1187534425 X:20125891-20125913 GGTAAGAAGCGGTCTCTTTAGGG + Exonic
1187711060 X:22054871-22054893 GGTAAGAAGTTGTCAGATTAGGG + Intronic
1187967593 X:24627781-24627803 GGTAAGAAGTGGTCAGATTCTGG + Intronic
1188016176 X:25110727-25110749 GGTGAGAAGCAGCCAGATTCTGG - Intergenic
1191968274 X:66785324-66785346 GGTGAGAAGTAGTCATATTCTGG - Intergenic
1192543614 X:71995168-71995190 GGTAACAAGTGGTTTGATTCTGG - Intergenic
1193502508 X:82297402-82297424 GGCAAGAAGCATTCTGATGGGGG - Intergenic
1193709873 X:84866793-84866815 GGTGAGAATCTGTCTGATTCTGG + Intergenic
1194461530 X:94175586-94175608 GGTAAGAAGTGGTCAGATTCTGG + Intergenic
1195374092 X:104209328-104209350 GGTAAGAAATAGTCAGATTCTGG - Intergenic
1196469084 X:116005092-116005114 GGAAAGGAGAAGTCTGAATCAGG + Intergenic
1198108234 X:133480903-133480925 GATGAGAAGTAGTCAGATTCTGG + Intergenic
1198428844 X:136546066-136546088 GGTAAGAAACACCCTGATGCAGG - Intronic
1198651875 X:138872099-138872121 GGGAAGAAGTAGTTAGATTCTGG + Intronic
1198839405 X:140840726-140840748 GGAAAGAAGCAGTATTATACAGG + Intergenic