ID: 928586676

View in Genome Browser
Species Human (GRCh38)
Location 2:32766234-32766256
Sequence GTTGTATTATGATCAAATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1850
Summary {0: 1, 1: 15, 2: 92, 3: 396, 4: 1346}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928586676 Original CRISPR GTTGTATTATGATCAAATCA GGG Intronic
900040691 1:461232-461254 GTTATAGTATGACCACATCAAGG + Intergenic
900062121 1:696203-696225 GTTATAGTATGACCACATCAAGG + Intergenic
900597373 1:3488037-3488059 GATGTCTAGTGATCAAATCAGGG + Intergenic
900758347 1:4453655-4453677 ATAGTCTAATGATCAAATCAGGG - Intergenic
900785597 1:4647858-4647880 AATGCATAATGATCAAATCAGGG + Intergenic
902090951 1:13902748-13902770 AATGTGTAATGATCAAATCAGGG - Intergenic
903195427 1:21683332-21683354 AGTGTATAATGATCACATCAGGG + Intronic
903487430 1:23701096-23701118 AATGTGTAATGATCAAATCAGGG - Intergenic
904309396 1:29618150-29618172 AATGTGTAATGATCAAATCAGGG - Intergenic
904509099 1:30987162-30987184 GTTGTATTATGTTACAAACATGG - Intronic
905162898 1:36052594-36052616 AATGTATAATGATCAAATCAGGG - Intronic
905694046 1:39962005-39962027 GTGCTATAATGATCACATCAGGG - Intronic
906164695 1:43677502-43677524 TTTGTATCAGGATTAAATCAAGG + Intronic
906189426 1:43886431-43886453 AATGTATTGTGATCCAATCAGGG - Intronic
906328022 1:44860621-44860643 ATTGCATTATGATTAAATTATGG - Intronic
906429918 1:45748208-45748230 AATGTATAATTATCAAATCAGGG - Intronic
906851568 1:49256230-49256252 AATGTATAATGATCTAATCAGGG - Intronic
906895028 1:49761631-49761653 GTTGCATAATGTTCAAATCGGGG + Intronic
906957221 1:50384587-50384609 ATTATATAATGATCAAATCAGGG + Intergenic
907033216 1:51192985-51193007 AATGTGTAATGATCAAATCAGGG + Intergenic
907261107 1:53219397-53219419 AATGTATTGTGATCAGATCAAGG - Intronic
907614649 1:55912078-55912100 AATGTATAATGATCAAATTAGGG - Intergenic
907672735 1:56491066-56491088 GATATACAATGATCAAATCAGGG + Intergenic
907747688 1:57230691-57230713 AATGTGTAATGATCAAATCAGGG + Intronic
908038272 1:60079645-60079667 AATGTATAATGATTAAATCAGGG + Intergenic
908375266 1:63530933-63530955 GTTGTATAATGATCAAATCAAGG + Intronic
908635444 1:66159145-66159167 ATTATGTAATGATCAAATCAGGG - Intronic
908788634 1:67759088-67759110 AATGTATAATGATCAAATCAGGG - Intronic
909101237 1:71351977-71351999 AATGTATAATGATTAAATCAGGG + Intergenic
909189466 1:72534183-72534205 ATTGTATAATGATCAAATTGGGG + Intergenic
909195310 1:72613606-72613628 AATGTATAATGATCAAATCAGGG - Intergenic
909342609 1:74548593-74548615 ATTGTGTAATGAACAAATCATGG - Intergenic
909460042 1:75901093-75901115 AATGTGTAATGATCAAATCAGGG + Intronic
909487652 1:76191584-76191606 GTTGTATAATGGTCAAATCATGG - Intronic
909516430 1:76512516-76512538 GTTGTATAATGATCAAATCAAGG + Intronic
909671838 1:78198178-78198200 ATTGTTTAATGATCCAATCAGGG + Intergenic
910147885 1:84103904-84103926 AATGTGTAATGATCAAATCAGGG + Intronic
910174961 1:84419567-84419589 ATTGTGTAATGATCAAATCATGG - Intergenic
910625338 1:89301107-89301129 ATTATATAATGATAAAATCAGGG + Intergenic
910731518 1:90402613-90402635 ATAGTGTAATGATCAAATCAGGG + Intergenic
910931818 1:92450256-92450278 AATGTGTGATGATCAAATCAGGG + Intergenic
911082232 1:93944542-93944564 GTTGTATAGTGATCAAATCAGGG + Intergenic
911238950 1:95443776-95443798 AATGTATAATGATCAAATCTGGG + Intergenic
911393888 1:97280942-97280964 ATTGTATAATGATCAAATCGGGG - Intronic
911405385 1:97431634-97431656 AATGTGTAATGATCAAATCAGGG + Intronic
911433388 1:97823074-97823096 ATTGTGTAATGATCAAATCAAGG + Intronic
911447318 1:98013766-98013788 AATGTATAATGATCAAATCAGGG - Intergenic
911488988 1:98538924-98538946 GATGTGTAATGATCAAATCAGGG + Intergenic
911614916 1:99999518-99999540 AATGTGTAATGATCAAATCAGGG + Intronic
911968276 1:104395617-104395639 ATTGTGTAATGATCAAATCAGGG - Intergenic
912025496 1:105165492-105165514 ATTGTGTAATGATCAAATCAAGG - Intergenic
912108985 1:106316828-106316850 AATGTATAATCATCAAATCAGGG - Intergenic
912324308 1:108743622-108743644 AATGTATAATGATCAAATCAGGG + Intergenic
912583493 1:110740399-110740421 GTTGTATGATGATCAAATTAGGG - Intergenic
912592678 1:110842039-110842061 ATAGTGTAATGATCAAATCAGGG + Intergenic
912620611 1:111152911-111152933 AGTGTATAATGATCAGATCAGGG + Intronic
912742243 1:112211206-112211228 AATGTATAATGATCACATCAGGG - Intergenic
912831971 1:112960910-112960932 GTTGTATACTGATCAAATCAGGG + Intergenic
913381147 1:118211617-118211639 AATGTATAATGATCAAAGCAAGG + Intergenic
913422275 1:118683881-118683903 AATGTATAATGATCAATTCAGGG - Intergenic
914696589 1:150088003-150088025 ATTGTGTAGTGATCAAATCAGGG + Intronic
914973555 1:152334541-152334563 ATTATGTAATGATCAAATCAGGG + Intergenic
915029521 1:152865861-152865883 AATGTGTAATGATCAAATCAGGG + Intergenic
915090890 1:153424968-153424990 AATGTATAATGATCAAGTCATGG - Intergenic
915163019 1:153932964-153932986 GGTGTATGATGAGGAAATCATGG - Exonic
915328683 1:155094732-155094754 GTAGTATTATGAACCAATAAAGG - Intergenic
915486415 1:156224224-156224246 GTTGTATAATGATCCAATCAGGG + Intronic
915800313 1:158784352-158784374 ATTGTGTAATAATCAAATCAGGG + Intergenic
915843187 1:159233546-159233568 CATGTGTAATGATCAAATCATGG - Intergenic
915946288 1:160154441-160154463 AATGTGTAATGATCAAATCAGGG + Intronic
916282353 1:163065898-163065920 GTTGTATAGTGATAAAATCAGGG + Intergenic
916296308 1:163223992-163224014 GTTGTGTAATGATCAAATCATGG + Intronic
917044286 1:170840394-170840416 AATGTATAATGATCAAATCAGGG + Intergenic
917261047 1:173169947-173169969 AATGTATAATGATCAAGTCATGG - Intergenic
917302761 1:173594365-173594387 AATGTATAATGATCAGATCAGGG - Intronic
917349923 1:174066299-174066321 GATGCATAATAATCAAATCAGGG - Intergenic
917383599 1:174442661-174442683 AATGTGTAATGATCAAATCAGGG + Intronic
917445182 1:175100937-175100959 AATGTGTGATGATCAAATCAGGG + Intronic
917569839 1:176253554-176253576 AATGTATAATGACCAAATCAGGG + Intergenic
917704236 1:177615618-177615640 AATGTGTAATGATCAAATCAGGG - Intergenic
918121927 1:181547807-181547829 GTTATATTCTGATAAAATAAAGG - Intronic
918135124 1:181665664-181665686 GTTGTTTAATGATTAAATCAGGG - Intronic
918147272 1:181768008-181768030 AATGTGTAATGATCAAATCAGGG + Intronic
918155231 1:181838576-181838598 ATTATATAGTGATCAAATCAGGG - Intergenic
918199381 1:182253099-182253121 AATGTATAATGAGCAAATCAGGG - Intergenic
918295661 1:183153919-183153941 AATGTATGATGATCAAATCATGG + Intergenic
918416383 1:184312261-184312283 GTTGTATAATGATCAAATCAGGG + Intergenic
918475542 1:184920320-184920342 AATGTGTAATGATCAAATCAGGG + Intronic
918578743 1:186099215-186099237 ATTGTGTAATTATCAAATCAGGG - Intronic
918609233 1:186467464-186467486 AATGTTTAATGATCAAATCATGG - Intergenic
918664731 1:187136379-187136401 GTTGTATAATAATCAAATCAGGG - Intergenic
918667117 1:187165081-187165103 AATGTATAATGATCAAATTATGG + Intergenic
918735211 1:188053099-188053121 GTTGCACAATGATCAAATCAGGG + Intergenic
918783978 1:188740854-188740876 ATTGTATTATACTCAAATAATGG - Intergenic
918901651 1:190428720-190428742 AATGTATAAAGATCAAATCAAGG - Intronic
918926089 1:190788271-190788293 TTTTTATTATGATCACTTCAAGG - Intergenic
918947494 1:191087069-191087091 AATGTGTAATGATCAAATCAGGG - Intergenic
919083863 1:192897247-192897269 ATTGTGTAATGATCAAATCATGG - Intergenic
919157311 1:193782801-193782823 AATGTGTAATGATCAAATCAGGG - Intergenic
919276922 1:195430898-195430920 ATTGTGTAATGATCAAATTAGGG + Intergenic
919563821 1:199158958-199158980 ATTGTCTAATGATCAAATCATGG - Intergenic
919591258 1:199505727-199505749 TTTGTATTATAATAAACTCATGG - Intergenic
920858057 1:209679447-209679469 ATTGTATAATGATCAAATCAAGG + Intergenic
920994685 1:210977844-210977866 AATGTGTAATGATCAAATCAGGG + Intronic
921113398 1:212062056-212062078 AATGTGTTATGATCAAGTCAGGG - Intronic
921113686 1:212065424-212065446 TATGTATAATGATCAAATCAGGG + Intronic
921468192 1:215516892-215516914 AATGTATAATGGTCAAATCAGGG + Intergenic
922523781 1:226281543-226281565 AGTGTGTAATGATCAAATCAGGG - Intronic
922545684 1:226455005-226455027 AATGTGTAATGATCAAATCAGGG + Intergenic
922967985 1:229708077-229708099 AATGTGTAATGATCAAATCAGGG - Intergenic
922979425 1:229813142-229813164 ATTATATAATGATCAGATCAGGG - Intergenic
923065869 1:230516933-230516955 AATGTGTAATGATCAAATCAGGG + Intergenic
923138732 1:231142193-231142215 GTTGTATAATGATCAGATTGGGG - Intergenic
923336561 1:232976211-232976233 ATTGTATAATGATCAAATCAGGG + Intronic
923421079 1:233815791-233815813 AATGTGTAATGATCAAATCAAGG - Intergenic
923778529 1:237000934-237000956 GATGTGTAATGATCAAGTCAGGG - Intergenic
923796173 1:237157944-237157966 AATGTATAATGATGAAATCAGGG - Intronic
923835036 1:237601644-237601666 ATTGTGTAATGATCAAATCAGGG - Intronic
923841226 1:237672533-237672555 AATGTGTAATGATCAAATCAGGG + Intronic
924108696 1:240675747-240675769 TATGTATAATGATCAAATTAGGG + Intergenic
924164038 1:241263654-241263676 TGTGTATAATGATCAAGTCAGGG - Intronic
924488063 1:244506696-244506718 AATGTGTAATGATCAAATCAGGG + Intronic
924664473 1:246056694-246056716 AATGCATAATGATCAAATCAGGG - Intronic
924824824 1:247528315-247528337 CTTGTGTAATGATCAAATCAAGG + Intronic
924863398 1:247950977-247950999 AATGTGTAATGATCAAATCAGGG - Intronic
924865932 1:247979925-247979947 GTTATATAATGATCTAATCAGGG - Intronic
924867233 1:247996951-247996973 GCTGTATAATGATCCAGTCAGGG - Intronic
924868487 1:248012714-248012736 GTTACATAATGATCTAATCAGGG - Intronic
924869828 1:248029071-248029093 GTTGTATAATGATCCAGTCGGGG - Intronic
924887750 1:248238067-248238089 TTTGCATAATGATCAAATCAGGG - Intergenic
1062903616 10:1164496-1164518 GTTGTGTAATGATCCAATCAGGG + Intergenic
1063034978 10:2277611-2277633 AATGTGTGATGATCAAATCAAGG - Intergenic
1063749411 10:8925793-8925815 AATGTGTAATGATCAAATCAGGG + Intergenic
1063789728 10:9429140-9429162 CATGTATAGTGATCAAATCAGGG - Intergenic
1063864434 10:10348627-10348649 AATATATAATGATCAAATCAGGG + Intergenic
1064474927 10:15677342-15677364 GATGTGTAATGATCAAATCAGGG - Intronic
1064597115 10:16956953-16956975 ATTGTGTAATTATCAAATCATGG + Intronic
1064717617 10:18193109-18193131 AATGTATAATGATCAAATCAGGG + Intronic
1064797463 10:19029370-19029392 AATGTGTAATGATCAAATCAGGG - Intergenic
1064803575 10:19104956-19104978 ATTGTGTAATGATTAAATCAGGG + Intronic
1064822605 10:19354809-19354831 GATGTGTAATGATCAAATCAGGG - Intronic
1064825703 10:19397031-19397053 ATTGTGTAATGATCAAATCAGGG + Intronic
1064842462 10:19610154-19610176 TTTGTATAATAATCAAATCAGGG + Intronic
1064856194 10:19770261-19770283 AATGTATAGTGATCAAATCAGGG + Intronic
1064969774 10:21053058-21053080 AATGTATAGTGATCAAATCAAGG - Intronic
1065145460 10:22763731-22763753 AGTGTATAATGATCAAATCAGGG - Intergenic
1065368385 10:24956590-24956612 ATTGCATAATGATCAACTCAGGG + Intergenic
1065460236 10:25954164-25954186 GTTGTTTTATTATAGAATCATGG - Intronic
1065518304 10:26546498-26546520 ATTGTGTAATCATCAAATCATGG + Intronic
1065764870 10:29019237-29019259 ATTGCATGATAATCAAATCAGGG - Intergenic
1065798196 10:29326630-29326652 GATGTATTAAGATAAAATTATGG - Intergenic
1066124161 10:32323049-32323071 AATGTGTAATGATCAAATCAGGG - Intronic
1066535171 10:36383273-36383295 ATTGTAGAATGACCAAATCAGGG + Intergenic
1066734774 10:38463705-38463727 AATGTGTAATGATCAAATCAGGG + Intergenic
1067020071 10:42788429-42788451 AATGTGTGATGATCAAATCAGGG + Intronic
1067499747 10:46792505-46792527 AATGTGTGATGATCAAATCAGGG + Intergenic
1067594884 10:47547821-47547843 AATGTGTGATGATCAAATCAGGG - Intronic
1067641992 10:48055918-48055940 AATGTGTGATGATCAAATCAGGG - Intergenic
1067707633 10:48622521-48622543 AATGTTTCATGATCAAATCAGGG + Intronic
1068024400 10:51625110-51625132 ATAGTATAATGATCAAAGCAGGG - Intronic
1068090650 10:52428801-52428823 AATGTATAATGATCAAATCAAGG + Intergenic
1068145451 10:53064151-53064173 ATTGTATAAAGATCAAATCAGGG + Intergenic
1068512073 10:57979184-57979206 GATGTATAATGATTGAATCAGGG - Intergenic
1068695214 10:59960681-59960703 ATTGTGTAATGATCAAATCAGGG + Intronic
1068697258 10:59981123-59981145 AATGTGTAATGATCAAATCAGGG - Intergenic
1068743921 10:60507084-60507106 TTTGTGTAATGATAAAATCAGGG - Intronic
1068764740 10:60750543-60750565 ATTGTGTAAAGATCAAATCAGGG - Intergenic
1068773859 10:60850905-60850927 GTTTCATTAGGCTCAAATCAAGG + Intergenic
1069011641 10:63380604-63380626 AATGTGTAATGATCAAATCAGGG + Intronic
1069241824 10:66150571-66150593 GATGTGTAATGATCAAATCAGGG + Intronic
1069351150 10:67529357-67529379 AATGTGTAATGATCAAATCAGGG - Intronic
1070049360 10:72872200-72872222 CATGTGTAATGATCAAATCAGGG + Intronic
1070076855 10:73144965-73144987 AATGTATAATGATCAAATCAGGG - Intronic
1070139180 10:73724424-73724446 AATGTGTGATGATCAAATCAAGG - Intergenic
1070317312 10:75327012-75327034 AATGTGTGATGATCAAATCATGG + Intergenic
1070462876 10:76687430-76687452 CATGTGTAATGATCAAATCAGGG + Intergenic
1070565004 10:77597426-77597448 AATGTATAATGATCAAGTCAGGG - Intronic
1070663151 10:78322251-78322273 AATGTATAATGATCAAATCAGGG + Intergenic
1070822970 10:79373700-79373722 ATTGCGTAATGATCAAATCAGGG - Intergenic
1071247235 10:83778312-83778334 GTTGTATTGTGATGAAATCAGGG - Intergenic
1071279848 10:84091105-84091127 TATGTGTTATGGTCAAATCAGGG - Intergenic
1071460577 10:85890350-85890372 GTTGTATAATGATCAAATCAGGG - Intronic
1071679216 10:87687728-87687750 CTTGTGTAATGATGAAATCAGGG - Intronic
1071967780 10:90870196-90870218 GTTGTATAATGAACAAATCAAGG - Intergenic
1072154356 10:92710854-92710876 AATGTGTAATGATCAAATCAGGG + Intergenic
1073436940 10:103523060-103523082 AATGTGTTATAATCAAATCAGGG + Intronic
1073698559 10:105898097-105898119 ATTGCATAATGATCAAATCAGGG + Intergenic
1073829809 10:107369890-107369912 AATGTATAGTGATCAAATCAAGG - Intergenic
1073997359 10:109331067-109331089 ATTGTGTAATGCTCAAATCAGGG - Intergenic
1074040975 10:109788078-109788100 GTTGTATAATGATCCAATCAGGG + Intergenic
1074624475 10:115165032-115165054 AATGTGTAATGATCAAATCAAGG - Intronic
1074626241 10:115190642-115190664 AATGTGTAATGATCAAATCAGGG + Intronic
1074636832 10:115328361-115328383 GTTGTATAATGGTCGAATCATGG + Intronic
1074738045 10:116456392-116456414 AATGTGTAATGATCAAATCAGGG - Intronic
1075490093 10:122859327-122859349 GTTGTATTCTGATGGAAGCATGG + Intronic
1075988934 10:126816253-126816275 AATGCATAATGATCAAATCAGGG - Intergenic
1076939106 10:133589962-133589984 AGTGTGTTATTATCAAATCAGGG + Intergenic
1076966964 11:97455-97477 GTTATAGTATGACCACATCAAGG + Intergenic
1077516631 11:3006078-3006100 GAGGTACTATGATCAAATCTAGG - Intronic
1077656041 11:4019722-4019744 AATGTATAATGATCAAATTAGGG + Intronic
1077945279 11:6890713-6890735 ACTGTATAATAATCAAATCAGGG + Intergenic
1078124420 11:8546371-8546393 AATGTGTAATGATCAAATCAGGG + Intronic
1078277861 11:9868062-9868084 GGTGTGTAATGGTCAAATCAGGG - Intronic
1079202888 11:18390473-18390495 AATGTATAATGATCAAATCTGGG + Intergenic
1079455098 11:20629574-20629596 AATGTGTAATGATCAAATCAGGG + Intronic
1079529469 11:21432794-21432816 AATGTGTAATGATCAAATCAGGG + Intronic
1079662141 11:23052358-23052380 AATGTATAATGATCAAAACAGGG - Intergenic
1079780024 11:24590349-24590371 GTTGTATAATAATCTAATCAGGG + Intronic
1079812417 11:25011766-25011788 ATTGTGTAATGATCAAGTCAGGG + Intronic
1079834705 11:25319785-25319807 ACTGTGTAATGATCAAATCAGGG + Intergenic
1079934793 11:26603884-26603906 GTTGTATAATTGTCAACTCAGGG + Intronic
1080334433 11:31180350-31180372 GTTATATAATGATCCAATCAGGG - Intronic
1080357453 11:31466966-31466988 AGTATATAATGATCAAATCAGGG - Intronic
1080622100 11:33995508-33995530 AATGTGTAATGATCAAATCAGGG + Intergenic
1080645646 11:34185881-34185903 ATTCTATAATGATCAAATCAGGG - Intronic
1080767028 11:35306525-35306547 AATGTGTGATGATCAAATCAGGG + Intronic
1080862098 11:36158862-36158884 GTTGTGTAATGATCAAATCAGGG + Intronic
1081059366 11:38454037-38454059 AATATATAATGATCAAATCAGGG - Intergenic
1081187278 11:40059249-40059271 ATTGTATGATGCTAAAATCAGGG - Intergenic
1081196286 11:40164809-40164831 ATGGTGTAATGATCAAATCAGGG - Intronic
1081369994 11:42288679-42288701 ATTGTAGAATGATCAAATCAGGG - Intergenic
1081624204 11:44637830-44637852 ATTGTGTGATGATCAAATCAGGG - Intergenic
1081708450 11:45200683-45200705 GTAGTGTTATGATAAAATCCAGG + Intronic
1081792752 11:45800218-45800240 AATGTATAATGATTAAATCAGGG + Intergenic
1081901859 11:46635388-46635410 ATTGTGTAATGATCAAATCAGGG + Intronic
1082687270 11:56256259-56256281 ATTGTAAAATGGTCAAATCAAGG - Intergenic
1082740780 11:56908629-56908651 GTTGTGTAATGATCAAGTCAAGG + Intergenic
1082754047 11:57054639-57054661 ATTGTGGAATGATCAAATCAGGG - Intergenic
1082901635 11:58260299-58260321 GATGTGTATTGATCAAATCAGGG + Intergenic
1083111181 11:60409082-60409104 ATTTTCTAATGATCAAATCATGG + Intronic
1083116945 11:60470133-60470155 GTTGTATAAATATCAACTCAAGG - Exonic
1083337079 11:61929095-61929117 AATGTATAATGATCAAATCTGGG + Intergenic
1083825024 11:65196420-65196442 AATGTGTAATGATCAAATCAGGG + Intronic
1084253281 11:67919882-67919904 AATGTGTAATGATCAAATCAGGG - Intergenic
1084819599 11:71676049-71676071 AATGTGTAATGATCAAATCAGGG + Intergenic
1084923934 11:72496491-72496513 AATGTGTAATGATCAAATCAGGG - Intergenic
1085142578 11:74160798-74160820 ATTGTGTAAGGATCAAATCAGGG - Intronic
1085585692 11:77703150-77703172 GTTGTAATATGATCACATTGAGG - Intronic
1085733964 11:79023249-79023271 GGTGAATTATATTCAAATCAAGG + Intronic
1085863774 11:80263654-80263676 AATGTGTAATGATCAAATCATGG + Intergenic
1086067957 11:82766240-82766262 AATGTGTAATGATCAAATCAGGG - Intergenic
1086068008 11:82766994-82767016 GTTGTAAAATAATTAAATCATGG - Intergenic
1086112438 11:83214662-83214684 AATGTATAAAGATCAAATCAAGG + Intronic
1086130620 11:83397960-83397982 CATGTATTGTGATCAGATCAGGG + Intergenic
1086138073 11:83462735-83462757 AATGTGTAATGATCAAATCAGGG - Intronic
1086589018 11:88489615-88489637 CTTGTATAATGATCAAATTAGGG + Intergenic
1086871337 11:92041001-92041023 AATGTATAATGATCAAATCAGGG + Intergenic
1086920180 11:92577498-92577520 ATTGTGGAATGATCAAATCAGGG + Intronic
1087080247 11:94163246-94163268 AATGTATAATGAGCAAATCAGGG + Intronic
1087346194 11:96973990-96974012 AATGTATAATGATCAAATCAGGG - Intergenic
1087363191 11:97186578-97186600 CATGTGTAATGATCAAATCAGGG - Intergenic
1087488801 11:98794892-98794914 AATGTGTAATGATCAAATCAGGG - Intergenic
1087556723 11:99730731-99730753 AATGTATAATGGTCAAATCAGGG + Intronic
1087603439 11:100344699-100344721 GATGTGTAAAGATCAAATCAGGG - Intronic
1087662013 11:100999352-100999374 AATGTGTAATGATCAAATCAGGG - Intergenic
1087675067 11:101152199-101152221 ATTGTATAATGATTGAATCAGGG + Intergenic
1087699927 11:101424379-101424401 GTTGTATAATGGTCAAATCAAGG + Intergenic
1087718299 11:101633863-101633885 AATGTGTAATGATCAAATCAGGG - Intronic
1087876697 11:103367525-103367547 GTTGTATAGTGATCAAATTACGG + Intronic
1088033905 11:105288061-105288083 GATGTGTAATGATCAAATCAGGG - Intergenic
1088143848 11:106650544-106650566 ATTGTGTAATGATCAAATCAGGG + Intergenic
1088390084 11:109304811-109304833 AATGTATAATAATCAAATCAGGG - Intergenic
1088392746 11:109333410-109333432 ATTTTAGAATGATCAAATCAAGG + Intergenic
1088540941 11:110913012-110913034 AATGTATAATGATCAAGTCAGGG + Intergenic
1088770263 11:113028238-113028260 GTTGTATAATGACCAAATCAGGG - Intronic
1088773202 11:113056449-113056471 AATGTGTAATGATCAAATCAAGG - Intronic
1088829784 11:113525742-113525764 ATTGTATAATGATGAAATCAGGG - Intergenic
1089117725 11:116109702-116109724 GATGTATAGTGATCAGATCAGGG + Intergenic
1089193747 11:116678489-116678511 AATGTATAATGATCAAATCAGGG - Intergenic
1089263036 11:117235819-117235841 GATGTATAGTGATCAGATCAGGG + Intronic
1089335754 11:117722587-117722609 AATGTGTAATGATCAAATCAGGG - Intronic
1089374436 11:117984615-117984637 GTTGAAGTATGATAACATCAAGG - Intergenic
1089375492 11:117991332-117991354 CTTGTGGAATGATCAAATCAAGG + Intronic
1089618333 11:119707760-119707782 AATGTATAATTATCAAATCAGGG - Intronic
1090088819 11:123675527-123675549 GTTGTAAAATGATCAAATCAGGG - Intergenic
1090140948 11:124260756-124260778 AATGTGTAATGATCAAATCAGGG + Intergenic
1090316078 11:125789799-125789821 AATGTGTAATGATCAAATCAGGG + Intronic
1090343279 11:126044931-126044953 AGTGTGTAATGATCAAATCAGGG - Intronic
1090490977 11:127160500-127160522 TTTGTTTTTTGATCAAATAATGG + Intergenic
1090590682 11:128263675-128263697 ATTGTGTGATGATCAAATCAGGG - Intergenic
1090847713 11:130544955-130544977 AATGTGTAATGATCAAATCAGGG + Intergenic
1091040498 11:132275766-132275788 GTTATATAATGATCCCATCAGGG + Intronic
1091116102 11:133015302-133015324 GTTGTATTATGAAGAAAGAAAGG + Intronic
1091404286 12:199309-199331 AATGTGTAATGATCAAATCAGGG + Intronic
1091969519 12:4773891-4773913 ATTTTATTATGAAAAAATCAAGG + Intronic
1092137125 12:6157901-6157923 GATGTATATTGATCAAATCAGGG + Intergenic
1092423520 12:8354700-8354722 AATGTGTAATGATCAAATCAGGG - Intergenic
1092578546 12:9815046-9815068 GTTGTGTAATTATCAAGTCAGGG - Intergenic
1092668427 12:10833542-10833564 AATGTGTAATGATCAAATCAAGG + Intronic
1092744400 12:11660112-11660134 GATGTGTAATGATCAGATCAGGG - Intronic
1092936702 12:13370637-13370659 AATGTGTAATGATCAAATCAAGG + Intergenic
1093052961 12:14524661-14524683 ATTGTGTAATGATCAAGTCATGG + Intronic
1093123753 12:15303865-15303887 GATGTATAATAATCACATCAGGG - Intronic
1093138792 12:15482581-15482603 ATTGTGTAATGAGCAAATCAGGG - Intronic
1093189238 12:16056288-16056310 AATGTGTAATGATCAAATCAGGG - Intergenic
1093243384 12:16705637-16705659 ATTGTGTAGTGATCAAATCAGGG - Intergenic
1093276856 12:17139735-17139757 ATTGCATGATGATCAAATCAGGG + Intergenic
1093287984 12:17289278-17289300 AATGTGTAATGATCAAATCAGGG - Intergenic
1093351494 12:18108140-18108162 GTTTTACTATGTTGAAATCAAGG - Intronic
1093592420 12:20918646-20918668 ATTGTGTAATAATCAAATCATGG + Intergenic
1093678233 12:21969035-21969057 AAGGTATAATGATCAAATCAGGG - Intergenic
1093722796 12:22463922-22463944 GTTTTATTATGATCAAAACTGGG + Intronic
1093725094 12:22497352-22497374 ATAGAATAATGATCAAATCAGGG - Intronic
1094203192 12:27813972-27813994 AATGTGTAATGATCAAATCAGGG + Intergenic
1094210949 12:27890845-27890867 ATTGTGTAATGATCAAATTAGGG + Intergenic
1094308520 12:29050391-29050413 AATGTGTAATGATCAAATCAGGG - Intergenic
1094445017 12:30520046-30520068 TTTGTGTAATGATCAAATCAGGG - Intergenic
1094462099 12:30707550-30707572 GTGGTAATATGATTAAATGATGG - Intergenic
1094723999 12:33093591-33093613 GTTGTATAATGATCAAATCAGGG + Intergenic
1094780432 12:33786178-33786200 ATTGTAAAATGATCAAATCAGGG + Intergenic
1095178979 12:39125059-39125081 AATGTATACTGATCAAATCACGG - Intergenic
1095241353 12:39862784-39862806 AATGTGTAATGATCAAATCAGGG + Intronic
1095361327 12:41343792-41343814 GTTGTATAATGATCAAATCAGGG - Intronic
1095499502 12:42821097-42821119 ATTGTGTAATGATCAAATCGTGG + Intergenic
1095598115 12:43982065-43982087 ATTGCATAATGATCAAGTCAGGG - Intronic
1095814959 12:46411215-46411237 AATGCATAATGATCAAATCAGGG - Intergenic
1095902782 12:47345689-47345711 AATGTGTAATGATCAAATCAGGG - Intergenic
1095924926 12:47568899-47568921 GGTGTGTCATGATCATATCAGGG + Intergenic
1096019939 12:48315717-48315739 AATGTGTGATGATCAAATCAGGG + Intergenic
1096058730 12:48678517-48678539 CTTGTGTCATGATCAAATCAGGG - Intronic
1096213815 12:49787471-49787493 ATTGTATAGTGATCAAATCAGGG + Intergenic
1096567485 12:52493451-52493473 ATTGTGTTAGGATCAAGTCAAGG - Intergenic
1096889465 12:54753461-54753483 AATGTTTAATGATCAAATCAGGG + Intergenic
1097769589 12:63566930-63566952 AATGTGTAATGATCAAATCAGGG + Intronic
1097798017 12:63884466-63884488 GTTGTATAATGATCTAGCCAGGG + Intronic
1097817905 12:64095812-64095834 AGTGTGTAATGATCAAATCAGGG + Intronic
1098018556 12:66131593-66131615 GTTGTATTATGTTCACTTTAGGG - Intronic
1098156469 12:67604268-67604290 GTTGTGTAATTATCAAATCAGGG + Intergenic
1098215380 12:68211008-68211030 AATGTGTTATGATTAAATCAGGG + Intronic
1098307385 12:69115660-69115682 AATGTGTAATGATCAAATCAGGG - Intergenic
1098376682 12:69822727-69822749 AACGTATAATGATCAAATCAGGG - Exonic
1098376816 12:69824273-69824295 AATGTGTAATGATCAAATCAGGG - Intronic
1098816657 12:75173861-75173883 AGTGTTTTAAGATCAAATCAAGG - Intronic
1098997869 12:77142584-77142606 ATTGTATAATGATCAAATCAAGG + Intergenic
1099091635 12:78317746-78317768 ATTGTATGATGATCAAGTCATGG + Intergenic
1099206649 12:79736199-79736221 AATGTGTAATGATCAAATCAGGG - Intergenic
1099400689 12:82199912-82199934 AATGTGTCATGATCAAATCAGGG - Intergenic
1099734762 12:86552583-86552605 AATGTATAATGATCAGATCAAGG - Intronic
1099810357 12:87573734-87573756 ATTGTATAGTGATCAAATCAGGG + Intergenic
1099922152 12:88972074-88972096 GTTGTATCAAGATCCTATCATGG - Intergenic
1099948353 12:89271483-89271505 GAAGTGTAATGATCAAATCAGGG + Intergenic
1099950763 12:89300341-89300363 ATTGTGTGGTGATCAAATCAGGG - Intergenic
1099993782 12:89754520-89754542 ATTGTGTAATGACCAAATCAGGG - Intergenic
1100024835 12:90115207-90115229 GATGTGTAATGATCAACTCAAGG + Intergenic
1100067400 12:90665718-90665740 GTTGTATTATGAGTGAATTAAGG - Intergenic
1100113808 12:91277890-91277912 AATGTATAATGATCAAGTCAGGG - Intergenic
1100114448 12:91287019-91287041 GTTGTATAATGATCCATTCAGGG - Intergenic
1100124773 12:91410332-91410354 AATGTGTAATGATCAAATCAGGG + Intergenic
1100234582 12:92647681-92647703 ATAGTGTAATGATCAAATCAGGG - Intergenic
1100415039 12:94363235-94363257 AATGTGTAATGATCAAATCAGGG - Intronic
1100662237 12:96712456-96712478 AATGTGTAATGATCAAATCAGGG + Intronic
1100765495 12:97860967-97860989 AATGTGTAATGATCAAATCAGGG - Intergenic
1101017471 12:100516967-100516989 ATTGTGTAATGATCAAATCAGGG + Intronic
1101240697 12:102835823-102835845 ATTGTAAAATGATTAAATCAAGG + Intergenic
1101665541 12:106809764-106809786 AATGTATAATGATCAAATCAGGG + Intronic
1101675916 12:106916128-106916150 GGTGTGTAATGATCAACTCAGGG + Intergenic
1101703646 12:107199247-107199269 GATGTATAATAATCACATCAAGG + Intergenic
1101745332 12:107537436-107537458 AATGTATGATGATCAAATCAGGG - Intronic
1102599102 12:114015500-114015522 AATGTATAATGATCAAATCAGGG + Intergenic
1102734692 12:115148702-115148724 ATTGTGTAATGATCAAATCAGGG + Intergenic
1102762392 12:115399502-115399524 AATGTGTAATGATCAAATCAGGG - Intergenic
1103279613 12:119745723-119745745 AATGTGTAATGATCAAATCAGGG - Intronic
1103416438 12:120744865-120744887 AATGTTTAATGATCAAATCAGGG - Intergenic
1104155578 12:126128069-126128091 AATGTGTAATGATCAAATCAGGG + Intergenic
1104164920 12:126218549-126218571 AATGTATAGTGATCAAATCAGGG + Intergenic
1104347282 12:128011947-128011969 ATTGTATTATCATCAATTAATGG + Intergenic
1105203313 13:18197213-18197235 ATTGGGTAATGATCAAATCAGGG + Intergenic
1105340440 13:19518288-19518310 ATTGCATAATGATCAAATCATGG - Intronic
1105348346 13:19594165-19594187 AATGTGTAATGATCAAATCAGGG - Intergenic
1105657941 13:22460620-22460642 GATATATAATGATCAGATCAGGG + Intergenic
1105681634 13:22734204-22734226 GTTGTATAATGATTAAATCTGGG - Intergenic
1105682304 13:22741625-22741647 AATGTGTAATGATCAAATCAGGG - Intergenic
1105689190 13:22818788-22818810 GTTGTATAATGATGAAATCAGGG + Intergenic
1105938700 13:25127799-25127821 AATATATAATGATCAAATCAAGG - Intergenic
1106198142 13:27511447-27511469 GATGTGTAATGATCAAATCTGGG + Intergenic
1106505231 13:30365342-30365364 ATTGTGTAATGATCGAATCAAGG + Intergenic
1106721361 13:32438056-32438078 ATTGTGTAATGATCAAATCATGG + Intronic
1106859454 13:33889490-33889512 ATTGTATAATGATCAAATCAGGG + Intronic
1106863907 13:33942398-33942420 AATGTATAATAATCAAATCAGGG + Intronic
1106867050 13:33976620-33976642 AATGTGTAATGATCAAATCAGGG - Intergenic
1106919058 13:34543129-34543151 TTTATGTAATGATCAAATCAGGG + Intergenic
1106939925 13:34767120-34767142 GTTGTATAATAATCAAATAAGGG + Intergenic
1107205774 13:37785635-37785657 GGTGAATTATGATTCAATCAAGG + Intronic
1107210445 13:37847570-37847592 ATTTTATAATGATCAAATTAGGG - Intronic
1107460298 13:40595542-40595564 AGTGTATAATGATCAAATCAGGG + Intronic
1107543262 13:41413054-41413076 GATGTGTAATGATCAAGTCAGGG + Intergenic
1107575278 13:41712308-41712330 AATGTATAATGATCAAGTCAGGG - Intronic
1107686628 13:42906915-42906937 GTTGTAAAATGATCAAATCAGGG + Intronic
1108120232 13:47177892-47177914 AATGTATAGTGATCAAATCAAGG + Intergenic
1108242442 13:48479728-48479750 AATGTGTAATGATCAAATCAGGG + Intronic
1108249879 13:48553572-48553594 AATGTGTAATGATCAAATCAAGG + Intergenic
1108276213 13:48812324-48812346 AATGTGTAATGATCAAATCAGGG + Intergenic
1108413112 13:50170108-50170130 AATGTGTAATGATCAAATCAGGG + Intronic
1108635004 13:52324418-52324440 ATGGTATAATGATCAAATCATGG - Intergenic
1108645518 13:52423196-52423218 ACTGCATAATGATCAAATCAGGG - Intronic
1108652800 13:52498770-52498792 ATGGTATAATGATCAAATCATGG + Intergenic
1108790510 13:53964706-53964728 AATGTGTAATGATCAAATCAGGG - Intergenic
1108893009 13:55285403-55285425 AATGCATAATGATCAAATCAGGG - Intergenic
1109133321 13:58615196-58615218 GTCCTATAATGATCAAATGATGG - Intergenic
1109154174 13:58884330-58884352 ATTGTATTATGAAGAATTCAGGG - Intergenic
1109290233 13:60465001-60465023 AATGTGTAATGATCAAATCAGGG - Intronic
1109423547 13:62144704-62144726 AATGTATAATGATCAAATCTGGG + Intergenic
1109593591 13:64520723-64520745 AATGTGTAATGATCAAATCAAGG + Intergenic
1109615119 13:64823940-64823962 GTTGTGTAATGATCAAACCATGG - Intergenic
1109696982 13:65973558-65973580 AATGTATGATGATCAAATCAGGG + Intergenic
1109753818 13:66732200-66732222 GATGTGTCAGGATCAAATCAGGG + Intronic
1109793070 13:67275092-67275114 GATGTATAATTATCAAATCAAGG - Intergenic
1109908022 13:68871377-68871399 AATGTGTAATGATCAAATCAGGG + Intergenic
1110082526 13:71333945-71333967 AATGTGTAATGATCAAATCAGGG + Intergenic
1110252224 13:73393286-73393308 AATGTGTAATGATCAAATCAGGG + Intergenic
1110778484 13:79437413-79437435 AATGTATAATGATCAAGTCAAGG + Intergenic
1110951704 13:81501175-81501197 AATGTATAAGGATCAAATCAGGG + Intergenic
1111013321 13:82341436-82341458 ATTGTAAAATGATCAAATCAGGG - Intergenic
1111014017 13:82353285-82353307 ATTGTATAATGATCAAATTGGGG + Intergenic
1111050003 13:82870352-82870374 GTTGTATAAGGATCAAATCAAGG - Intergenic
1111073075 13:83195289-83195311 GTTGTACAATGATCAAATCAGGG - Intergenic
1111204323 13:84984639-84984661 AATGTGTAATGATCAAATCAGGG - Intergenic
1111228434 13:85307628-85307650 ATTGCATAATGAGCAAATCAGGG + Intergenic
1111341076 13:86886761-86886783 AATGTATTATAATAAAATCAGGG - Intergenic
1111522023 13:89417637-89417659 GTTGTTTTGTGATCACCTCATGG + Intergenic
1111602356 13:90490989-90491011 ATTTTGTAATGATCAAATCATGG + Intergenic
1111616895 13:90671114-90671136 ACTGTATAATGATCAAATCAGGG - Intergenic
1111632750 13:90863522-90863544 ATGGTATAATGATTAAATCAGGG - Intergenic
1111766853 13:92542115-92542137 CATGTGTAATGATCAAATCAGGG + Intronic
1111854668 13:93622693-93622715 ATTGTACCATGATCTAATCAGGG + Intronic
1111870400 13:93825010-93825032 TTTGTATTACAAACAAATCATGG + Intronic
1111939383 13:94593406-94593428 AATGTGTAATGATCAAATCAGGG - Intronic
1112177468 13:97041131-97041153 AATGTATAGTGATCAAATCAGGG + Intergenic
1112182005 13:97092502-97092524 AATGTATAATGATCAAATCAGGG - Intergenic
1112256368 13:97835700-97835722 AATGTTTAATGATCAAATCAGGG + Intergenic
1112658685 13:101481863-101481885 AATGTATAATGATCAAATCAAGG + Intronic
1112667559 13:101593964-101593986 GTTGCATTATGATCAAATTAGGG - Intronic
1112685637 13:101822658-101822680 ATTGTGTAACGATCAAATCAGGG + Intronic
1112690473 13:101887794-101887816 AATGTGTAATGATCAAATCAGGG - Intronic
1112764685 13:102728220-102728242 AATGTGTAATGATCAAATCAGGG - Intergenic
1112790045 13:102993287-102993309 ATTGTATAATAATCAAATCAGGG + Intergenic
1112817522 13:103290567-103290589 GTTGCATAATGATCTAATCAGGG - Intergenic
1112849538 13:103687951-103687973 GTTGTGTAATGATCAAATCAGGG + Intergenic
1112876388 13:104044957-104044979 GTATGATAATGATCAAATCAGGG - Intergenic
1113177542 13:107582275-107582297 GTTATATTATGGACAAAGCAGGG - Intronic
1113365983 13:109676286-109676308 GTGGTCTTCTGATTAAATCATGG - Intergenic
1114061235 14:19017498-19017520 GGTGAATTATGATCAAACCACGG - Intergenic
1114066573 14:19064222-19064244 GTTGGGTAATGATCAAATCAGGG + Intergenic
1114095693 14:19335802-19335824 GTTGGGTAATGATCAAATCAGGG - Intergenic
1114101017 14:19382488-19382510 GGTGAATTATGATCAAACCACGG + Intergenic
1114370464 14:22081875-22081897 AATGTACAATGATCAAATCAGGG - Intergenic
1114592569 14:23880654-23880676 ATTGTATAATGATCAAATCAGGG - Intergenic
1114698744 14:24654427-24654449 AATATATAATGATCAAATCAGGG + Intergenic
1114906398 14:27133061-27133083 CTTGTATAATGATCAAGTCAGGG + Intergenic
1115052790 14:29084972-29084994 GATGTGTTATGTTCAAATCATGG + Intergenic
1115085963 14:29515043-29515065 AATGTACAATGATCAAATCAGGG + Intergenic
1115131629 14:30059713-30059735 ATTGTATAATAACCAAATCAGGG + Intronic
1115270551 14:31547422-31547444 AATGTGTAATGATCAAATCAGGG + Intronic
1115281632 14:31669238-31669260 ATTGTATCATAATTAAATCAGGG + Intronic
1115313152 14:31999689-31999711 GATGTATAATGATTAAATCAGGG + Intergenic
1115331697 14:32204471-32204493 GTTGTATAACGATCCAATCAAGG + Intergenic
1115414618 14:33117134-33117156 GCTGTATAATCATCCAATCAGGG + Intronic
1115658197 14:35464468-35464490 ATTGTATAATAATCAAATCAGGG + Intergenic
1115737578 14:36350579-36350601 AATGTGTAATGATCAAATCAGGG - Intergenic
1116043297 14:39712427-39712449 CTTGAATTAGGGTCAAATCAAGG + Intergenic
1116082726 14:40196451-40196473 AATGTATAATGATCAAATCAGGG - Intergenic
1116162074 14:41280760-41280782 ATTGTATAATGATCAAATTAGGG + Intergenic
1116232367 14:42233941-42233963 AATGCATAATGATCAAATCATGG - Intergenic
1116254653 14:42536123-42536145 AATGTGCTATGATCAAATCAAGG + Intergenic
1116543315 14:46128260-46128282 AATGTGTAATGATCAAATCAAGG - Intergenic
1116559639 14:46361176-46361198 ATTGTGTAATAATCAAATCAGGG - Intergenic
1116616120 14:47141926-47141948 ATTGTATCATAATCAAATCAGGG - Intronic
1116893090 14:50288048-50288070 AATGTGTAATGATCAAATCAGGG + Intronic
1116896648 14:50322511-50322533 GGTGGATTATGATCGCATCAGGG + Exonic
1117423731 14:55574175-55574197 TTTGTATGAGGATCCAATCAAGG + Intronic
1117725750 14:58671951-58671973 GTTTTATAATGAAGAAATCAAGG - Intergenic
1117848610 14:59941740-59941762 AATGTATAATGATCAAATAAGGG + Intronic
1117892305 14:60439115-60439137 AATGTGTAATGATCAAATCAGGG - Intronic
1117917482 14:60692914-60692936 AATGTATAGTGATCAAATCAAGG + Intergenic
1117917573 14:60693754-60693776 AATGTATAGTGATCAAATCAAGG - Intergenic
1118040964 14:61916518-61916540 TATGTATAATGATGAAATCAGGG + Intergenic
1118087034 14:62429530-62429552 AATGTTTAATGATCAAATCAGGG + Intergenic
1118121664 14:62852135-62852157 AATGTATAATGATCAAATCAGGG + Intronic
1118371420 14:65140448-65140470 AGTGTGTAATGATCAAATCAGGG - Intergenic
1118693050 14:68358854-68358876 CTTGTTTTATGATTATATCATGG + Intronic
1118956408 14:70486615-70486637 GTTGTATAATGATCCAATCTGGG - Intergenic
1119314434 14:73680583-73680605 GTTGTGTAATGATCAAACCAAGG + Intronic
1119371061 14:74143714-74143736 GTTGTATAAAGATCAAATCAGGG + Intronic
1119372216 14:74156576-74156598 AATGTGTAATGATCAAATCAGGG + Intronic
1119962098 14:78870455-78870477 CATGTGTAATGATCAAATCAGGG + Intronic
1120030450 14:79635130-79635152 ATTGTATAATGATCAAATCTGGG - Intronic
1120073420 14:80128392-80128414 AATGTGTAATGATCAAATCAGGG + Intergenic
1120151670 14:81042848-81042870 GTTGTGTAATGACCAAATCAGGG - Intronic
1120255732 14:82117072-82117094 GTTTTAACATGATAAAATCAGGG + Intergenic
1120260078 14:82172776-82172798 GTTATATTATGATCAAATCAAGG + Intergenic
1120727425 14:87960461-87960483 GTGGTATAATGGTCAAATCAGGG - Intronic
1120795744 14:88631268-88631290 GGTGTGTCATGATCACATCATGG - Intronic
1120816199 14:88861422-88861444 AATGTGTAATGATCAAATCAGGG + Intronic
1120817380 14:88876561-88876583 AAGGTATAATGATCAAATCAGGG - Intronic
1121581062 14:95031153-95031175 ATTGTGTAATGATCAAATAAGGG - Intergenic
1121681675 14:95798164-95798186 AATGTATCACGATCAAATCAGGG + Intergenic
1121697582 14:95926361-95926383 GTTGTATTGTGATCAATACAGGG - Intergenic
1121887272 14:97555083-97555105 AATGTGTGATGATCAAATCAGGG + Intergenic
1121987513 14:98522109-98522131 AATGTGTAATGATCAAATCAGGG + Intergenic
1122189271 14:100027182-100027204 AATGTGTAATGATCAAATCAGGG + Intronic
1122656233 14:103261359-103261381 AATTTATAATGATCAAATCAGGG + Intergenic
1123506976 15:20952236-20952258 ATTGTGTAATGATCAAATGAAGG - Intergenic
1123564204 15:21525990-21526012 ATTGTGTAATGATCAAATGAAGG - Intergenic
1123600458 15:21963272-21963294 ATTGTGTAATGATCAAATGAAGG - Intergenic
1123885330 15:24721241-24721263 GATGTATAATGATTAAGTCAGGG + Intergenic
1124020467 15:25917704-25917726 AATGTATAATGATCAAATGAGGG + Intergenic
1124120914 15:26887840-26887862 AGTGTATAATGATCAAATCAGGG + Intronic
1124477436 15:30046965-30046987 ATTGTATAATGACCAAATCTGGG - Intergenic
1124576720 15:30915647-30915669 AATGTATAATGATCAAATTAGGG - Intronic
1124615376 15:31237837-31237859 CATGTATGGTGATCAAATCAGGG + Intergenic
1124711006 15:32011238-32011260 AATGTGTAATGATCAAATCAGGG - Intergenic
1124862614 15:33457779-33457801 GTTGTATGATGATGAAATCAGGG - Intronic
1124913877 15:33949461-33949483 AATGAATAATGATCAAATCAGGG - Intronic
1125012569 15:34896267-34896289 ATTGTGTAATGATCAAATCAGGG - Intronic
1125038415 15:35154233-35154255 GTTGTGTAATGGTCAAATCAGGG - Intergenic
1125040304 15:35178024-35178046 GTTGTATGAAGATCAGATCAGGG + Intergenic
1125559681 15:40618719-40618741 ATTGTGTAATGATCAAATCAGGG - Intronic
1125840093 15:42792248-42792270 AATGTGTTGTGATCAAATCAGGG - Intronic
1125896124 15:43303175-43303197 AATGTATAATGATCAAATCAGGG - Intergenic
1126226387 15:46275154-46275176 ATTGTATAATGATCAAATCGGGG - Intergenic
1126237121 15:46398955-46398977 GTTATATAATGAGCAAGTCAGGG - Intergenic
1126308673 15:47290263-47290285 GTTGCATTATTTTCAAATCTGGG - Intronic
1126369533 15:47931269-47931291 AATGTGTAATGATCAAATCAGGG - Intergenic
1126374296 15:47979768-47979790 AATGTATAATGATCAAATCATGG - Intergenic
1126472288 15:49026429-49026451 AATGTGTAATGATCAAATCAGGG - Intronic
1126809801 15:52390319-52390341 GATGTATAATAATCACATCATGG - Intronic
1126834703 15:52648400-52648422 GATGTGTAATGATCAAATCAGGG + Intronic
1126870999 15:52987551-52987573 ATTGTATAATGATCAAATCAGGG + Intergenic
1126921621 15:53532837-53532859 CATGTATAATGATGAAATCAGGG - Intronic
1127027476 15:54823265-54823287 ATTGTATAATGATCCAGTCAGGG + Intergenic
1127513565 15:59669136-59669158 ATTGTATAATGATCAAACCTGGG - Intronic
1128177650 15:65570380-65570402 CTGGTATTATGATCCAATGACGG - Intronic
1128871282 15:71157386-71157408 ATTATATAATGATCAAATCAGGG + Intronic
1129478594 15:75805022-75805044 AATGTATAATGATCAAATCAGGG - Intergenic
1129593381 15:76938033-76938055 ATATTATAATGATCAAATCAGGG + Intronic
1129597674 15:76977287-76977309 GATCCATAATGATCAAATCAGGG + Intergenic
1129614570 15:77088107-77088129 ATTGTGTGATGACCAAATCAGGG + Intergenic
1130106714 15:80934229-80934251 AATGTGTAATGATCAAATCAGGG + Intronic
1130174350 15:81552543-81552565 GATGTGTGATGATCAAATCAGGG - Intergenic
1130319325 15:82827569-82827591 AATGTGTAATGATCAAATCAGGG + Intronic
1130606366 15:85320883-85320905 AATGTGTAATGATCAAATCAGGG - Intergenic
1130709876 15:86269577-86269599 AATGTGTAATGATCAAATCAGGG - Intronic
1130754682 15:86750343-86750365 AATGTGTAATGATCAAATCAGGG + Intronic
1130798638 15:87237340-87237362 ATTATATAATGACCAAATCAAGG + Intergenic
1130973287 15:88752541-88752563 GGTGTGTTCTAATCAAATCAAGG + Intergenic
1131206195 15:90449936-90449958 AATGTATTATGATCAAATCAGGG + Intronic
1131239454 15:90726072-90726094 ACTGTATAATGATCAGATCAGGG + Intronic
1131386354 15:92011274-92011296 CTTACCTTATGATCAAATCAGGG + Intronic
1131582666 15:93660359-93660381 AATGTGTAATGATCAAATCAGGG + Intergenic
1131596692 15:93804804-93804826 GTTGTATAATGGTCCAATCAGGG + Intergenic
1132366252 15:101259251-101259273 AATGTGTAATGATCAAATCAGGG + Intergenic
1132441211 15:101866382-101866404 GTTATAGTATGACCACATCAAGG - Intergenic
1202972564 15_KI270727v1_random:253088-253110 ATTGTGTAATGATCAAATGAAGG - Intergenic
1133543397 16:6778941-6778963 AATGTGTAATGATCAAATCAAGG + Intronic
1133668100 16:7990490-7990512 AATGTGTAATGATCAAATCAGGG + Intergenic
1134781203 16:16897086-16897108 ATTGTATAATGATGAAATCAGGG + Intergenic
1134798606 16:17064487-17064509 GTTTTATCATCAGCAAATCAGGG - Intergenic
1135090548 16:19511493-19511515 AATGTATAATGATAAAATCAGGG + Intronic
1135402577 16:22176388-22176410 AGTGTGTAATGATCAAATCAGGG - Intronic
1135478167 16:22796331-22796353 CTTGTGTAATAATCAAATCAGGG + Intergenic
1135924738 16:26683426-26683448 AATGTGTAATGATCAAATCAGGG - Intergenic
1136601355 16:31291998-31292020 AATGTGTGATGATCAAATCAGGG - Intronic
1137912324 16:52390642-52390664 ATTGTATAATGACCGAATCAAGG - Intergenic
1138086317 16:54136831-54136853 AATGTGTAATGATCAAATCAGGG + Intergenic
1139044725 16:63042723-63042745 ATTGTGTAGTGATCAAATCAGGG + Intergenic
1139077445 16:63469655-63469677 ATTGTGTTATGTTCAAATCAGGG - Intergenic
1139132173 16:64159642-64159664 ATGGTATAATGATCAAATCAAGG + Intergenic
1140728034 16:77831527-77831549 GTTTTATCATGATTAAATTAGGG - Intronic
1141037167 16:80637821-80637843 GATGTGTAATGATCAAATCAGGG - Intronic
1141044041 16:80699725-80699747 AATGTGTAATGATCAAATCAGGG - Intronic
1141177264 16:81729338-81729360 ATTGTGTAATGATCAAATCAGGG + Intergenic
1141222101 16:82080555-82080577 ATTATCTTATGATAAAATCAAGG - Intronic
1141351054 16:83297287-83297309 ATTGTATAATGATCAAATCCAGG - Intronic
1142537871 17:632444-632466 GATGTATAATGATCAAATCAGGG + Intronic
1142902540 17:3021110-3021132 AATGCATAATGATCAAATCAAGG + Intronic
1142945051 17:3419571-3419593 TTTGTAAAATGATTAAATCAAGG - Intergenic
1143699121 17:8644673-8644695 ATTGCGTAATGATCAAATCATGG + Intergenic
1143816788 17:9522979-9523001 AATGTGTAATGATCAAATCAGGG - Intronic
1143835135 17:9685744-9685766 AGTGTGTAATGATCAAATCAGGG + Intronic
1144033704 17:11344714-11344736 CGTGTCTAATGATCAAATCAGGG + Intronic
1144054471 17:11526933-11526955 ATATTATAATGATCAAATCAGGG + Intronic
1144076504 17:11724120-11724142 GTAGTATAATGATCGAATCAGGG + Intronic
1144121407 17:12157441-12157463 AATGTATAATGATCAAATCAGGG + Intergenic
1144138352 17:12320981-12321003 ATGGTATAATGATCAAATCAGGG - Intergenic
1144225996 17:13147424-13147446 AATGTATAATGATCAAATCAGGG + Intergenic
1146265827 17:31451964-31451986 GTTGTGTAATGATCAAATCAGGG + Intronic
1146274291 17:31506324-31506346 ATTGTGGAATGATCAAATCAGGG + Intronic
1146389990 17:32413074-32413096 AATGTATAATGATCAAATCAGGG - Intergenic
1146412099 17:32595386-32595408 AAGGTATAATGATCAAATCAAGG - Intronic
1147508629 17:41046399-41046421 GTTGTGTAATAATCAAGTCAGGG - Intergenic
1147704770 17:42418782-42418804 AATGTATAATGATCAAATCAGGG - Intronic
1148109003 17:45134041-45134063 AATGTGTAATGATCAAATCAAGG + Intronic
1148631563 17:49113905-49113927 AATGTGTAATGATCAAATCAGGG - Intergenic
1148667487 17:49385692-49385714 GGTGTGTAATGATCAAATCTGGG - Intronic
1149115857 17:53095805-53095827 AATGCATAATGATCAAATCAGGG - Intergenic
1149130527 17:53295694-53295716 GTTGCATAATGATAAAATGAAGG + Intergenic
1149164325 17:53732570-53732592 ATTGTGTAATGATCAAATCAGGG - Intergenic
1149202904 17:54208494-54208516 AATGTATAATGATCAAATCAGGG - Intergenic
1149232247 17:54548131-54548153 AATGTGTAATGATCAAATCAGGG + Intergenic
1149406298 17:56355158-56355180 GTTGTATAATCATTAAATTAGGG - Intronic
1149832112 17:59881583-59881605 CATGTGTAATGATCAAATCAGGG + Intronic
1150158465 17:62873708-62873730 GATGTATAATGATCAGATCAGGG + Intergenic
1150768222 17:68019587-68019609 AATGTGTAATGATCAAATCAGGG + Intergenic
1150911933 17:69397037-69397059 ATTGTATAATGATCAAATCAGGG + Intergenic
1150985188 17:70188188-70188210 GTTGTATAATGATCGAAACAGGG + Intergenic
1151016206 17:70556179-70556201 AATGTGTAATGATCAAATCAAGG + Intergenic
1151081371 17:71333360-71333382 AGTGTGTTATGATCAAGTCAGGG - Intergenic
1151397181 17:73831096-73831118 CTTGTGTAAGGATCAAATCAGGG + Intergenic
1152005859 17:77680434-77680456 AATGTGTAATGATCAAATCAGGG + Intergenic
1152313755 17:79567568-79567590 AGTGTGTAATGATCAAATCAGGG - Intergenic
1152842390 17:82578520-82578542 GTTGTAATTTGATCAAACCCAGG - Intronic
1152993185 18:381390-381412 AGTGTATAATGATCAAATCATGG - Intronic
1153255855 18:3170332-3170354 AATGTGTAATGATCAAATCAGGG - Intronic
1153382859 18:4457270-4457292 AATGCATAATGATCAAATCAGGG + Intergenic
1153423856 18:4940716-4940738 AATGTGTAATGATCAAATCAGGG + Intergenic
1153459047 18:5313530-5313552 GATGGAATATGATCATATCAAGG - Intergenic
1153648346 18:7215725-7215747 ATTGTGTAATGATCAAACCAGGG + Intergenic
1153861314 18:9211144-9211166 CTTATATTATGTGCAAATCAAGG - Intronic
1153920951 18:9789440-9789462 AATGTGTAATGATCAAATCAGGG - Intronic
1154012191 18:10584332-10584354 GATGTGTAATGATCAAATCAGGG + Intergenic
1154055278 18:11006955-11006977 AATGTGTAATGATCAAATCAGGG + Intronic
1154072803 18:11168479-11168501 GTTGTATGATGACCAAATCTGGG + Intergenic
1154140033 18:11815180-11815202 ATAGTATAATGATCAAATCTGGG - Intronic
1154381618 18:13856464-13856486 ATTGTGTAATGATCAAATCAGGG - Intergenic
1154944790 18:21150957-21150979 GATATGTAATGATCAAATCAGGG + Intergenic
1155075714 18:22352375-22352397 ATTGTGTAATGATCAAATCAGGG + Intergenic
1155462820 18:26102646-26102668 AATGTATAATGATCAAATCTGGG - Intergenic
1155758249 18:29529628-29529650 AATGTGTAATGATCAAATCAAGG + Intergenic
1155982410 18:32195239-32195261 GTTATATTATGATAAAAGTAGGG + Intronic
1156161651 18:34366467-34366489 GAGGTATCATGATCAAATGAAGG + Intergenic
1156224829 18:35094164-35094186 ATTGTGTAATGATCAAATCAGGG - Intronic
1156680759 18:39585791-39585813 ATTGAATTATGATAATATCAAGG + Intergenic
1156910113 18:42401954-42401976 AATGTATAATGATCAAATCAAGG + Intergenic
1156966818 18:43104482-43104504 AATGTATAATGATCAAATAATGG - Intronic
1157092821 18:44656434-44656456 AATGTGTAATGATCAAATCAGGG + Intergenic
1157619115 18:49005588-49005610 AATGTGTAATGATCAAATCAGGG + Intergenic
1157656709 18:49397113-49397135 ATTGTGTAATGATTAAATCAGGG - Intronic
1157853729 18:51084262-51084284 GTGATATTATGCTCAAAACAAGG + Exonic
1158270731 18:55712776-55712798 AATGTATAATGATCAGATCAGGG + Intergenic
1158408350 18:57180411-57180433 AATGCATAATGATCAAATCAGGG + Intergenic
1158583943 18:58712733-58712755 GATATATAATGATCAAATCAGGG - Intronic
1158742355 18:60157555-60157577 GTTGTATGATGATTAAATCAGGG - Intergenic
1159138498 18:64364872-64364894 GTTGTATAATGATCAAATCAGGG - Intergenic
1159178365 18:64868243-64868265 AATGTGTGATGATCAAATCAGGG + Intergenic
1159180431 18:64894865-64894887 CTTGTATAATGATCAGATCAGGG - Intergenic
1159273156 18:66180055-66180077 ATTGTGTAATAATCAAATCAGGG + Intergenic
1159312477 18:66727149-66727171 ATTGTGCAATGATCAAATCAGGG + Intergenic
1159334693 18:67047126-67047148 ATTGTATAATGACCAAATCTGGG + Intergenic
1159363536 18:67436285-67436307 AGTGTATTATGAGCAAATCAAGG - Intergenic
1159496001 18:69205710-69205732 ATTGTATAATGCTCAAGTCAGGG - Intergenic
1159512740 18:69417007-69417029 AATGTATAATGATCAAATCTTGG + Intronic
1159698744 18:71596044-71596066 ATTGTGTAATGATCAAATTAGGG + Intergenic
1159750492 18:72294714-72294736 AATGTGTAATGATCAAATCAGGG - Intergenic
1160057905 18:75502908-75502930 GTTGTATAATGACCCAGTCAGGG - Intergenic
1160136629 18:76277263-76277285 GATATGTAATGATCAAATCAGGG - Intergenic
1160367437 18:78339395-78339417 AATGTGTAATGATCAAATCATGG + Intergenic
1160643767 19:167078-167100 GTTATAGTATGACCACATCAAGG + Intergenic
1163074641 19:14879074-14879096 GTTATATAATAATCACATCATGG + Intergenic
1164786743 19:30937537-30937559 CTTGTGCAATGATCAAATCATGG + Intergenic
1164856584 19:31529493-31529515 AATGTGTAATGATCAAATCAGGG + Intergenic
1166618855 19:44276863-44276885 AATGTGTAATGATCAAATCATGG + Intronic
1168017603 19:53586043-53586065 AATGTGTAATGATCAAATCAGGG - Intergenic
1168371756 19:55841077-55841099 ATTGTATAATGATCCAATCAGGG + Intronic
1168389289 19:55993175-55993197 AATGTATCATGATCAAATCAGGG + Intergenic
1168391908 19:56016076-56016098 ATTGTAGAATGATCAAATCAGGG + Intronic
1168502968 19:56909035-56909057 AATGTATGATGATCAGATCAGGG + Intergenic
925095880 2:1201674-1201696 GATGCATAATGATCAAAACAAGG - Intronic
925486229 2:4334999-4335021 GTTGTATAATGGTTAAATTAGGG + Intergenic
925889682 2:8423449-8423471 GATGTGTGATGATCTAATCAGGG + Intergenic
926516125 2:13849425-13849447 AATGTATAATGATCAAATCAGGG + Intergenic
926888016 2:17615410-17615432 GTTGTAGAGTGATCAAATCAGGG + Intronic
926891254 2:17640768-17640790 AATGTGTAATGATCAAATCAGGG + Intronic
926975084 2:18506918-18506940 GTTCAATAATGAACAAATCATGG - Intergenic
927008408 2:18876326-18876348 ATTGTGTAATGATCAAATTAGGG + Intergenic
927009238 2:18885019-18885041 GATGCGTAATGATCAAATCAAGG - Intergenic
927907066 2:26866612-26866634 AATGTGTAATGATCAAATCAGGG - Intronic
928586676 2:32766234-32766256 GTTGTATTATGATCAAATCAGGG + Intronic
928915069 2:36461785-36461807 GTTGTATTATGTTGAAAATAAGG + Intronic
929084058 2:38150101-38150123 AATGTGTAATGATCAAATCAGGG + Intergenic
929145058 2:38699325-38699347 AATGTATAAGGATCAAATCAGGG + Intronic
929296519 2:40254084-40254106 AATGTGTAATGATCAAATCAGGG - Intronic
929356805 2:41035045-41035067 ATTGTGTAATAATCAAATCAAGG + Intergenic
929651103 2:43680334-43680356 AATGTGTAATGATCAAATCAAGG - Intronic
929690976 2:44073109-44073131 AATGTATAATGATCAAATCAGGG - Intergenic
929729238 2:44469180-44469202 AATGTGTAATGATCAAATCAGGG - Intronic
930061020 2:47288710-47288732 AATGGATAATGATCAAATCAGGG + Intergenic
930161527 2:48162521-48162543 AATGTGTTATGATCAAATCAGGG - Intergenic
930196021 2:48511114-48511136 AGTGTGTAATGATCAAATCAGGG + Intronic
930253602 2:49063882-49063904 ATTGGGTAATGATCAAATCAGGG - Intronic
930258313 2:49116776-49116798 ATTGTAGAATGGTCAAATCAGGG + Intronic
930282352 2:49385633-49385655 GTTGTGTAATAATCGAATCAGGG + Intergenic
930429634 2:51257767-51257789 TATGTATAATGATCAATTCAGGG - Intergenic
930570686 2:53082439-53082461 ATTATATAATAATCAAATCAGGG - Intergenic
930592062 2:53339805-53339827 ATTCTGTAATGATCAAATCAAGG + Intergenic
930592609 2:53346924-53346946 AGGGTATAATGATCAAATCAGGG + Intergenic
930986549 2:57595700-57595722 ATTATATAATGATTAAATCAGGG + Intergenic
931358643 2:61559065-61559087 ATTGTATGATGATCAAATCAGGG + Intergenic
931581215 2:63777125-63777147 ATTGTATAATGGTCAAATCATGG - Intronic
931787404 2:65632519-65632541 GTTGTATAATGATTAAACTAGGG + Intergenic
931917486 2:66973424-66973446 GATGTATAGTGATCAAATCAGGG + Intergenic
932452482 2:71821937-71821959 ATTGTGTAGTGATCAAATCAGGG + Intergenic
932629623 2:73328173-73328195 AATGTGTAATGATCAAATCAGGG + Intergenic
932786480 2:74609003-74609025 ATTGTGTAATGATCAAATCAGGG + Intronic
932871343 2:75402054-75402076 AATGTATAATGACCAAATCAGGG + Intergenic
933053849 2:77636159-77636181 AATGCATAATGATCAAATCAGGG + Intergenic
933175796 2:79171272-79171294 AGTGTGTAATGATCAAATCAAGG - Intergenic
933175907 2:79172866-79172888 AGTGTGTAATGATCAAATCAGGG - Intergenic
933191020 2:79334015-79334037 AATGTGTAATGATCAAATCATGG + Intronic
933197221 2:79405714-79405736 CATGTATTCTGATCAAATCAGGG + Intronic
933217607 2:79648319-79648341 GTTCTAGTATGAACAAATTAGGG - Intronic
933292895 2:80457046-80457068 AATGTATAATGATCAAATCAGGG - Intronic
933324012 2:80813049-80813071 ATTGTGTAATGATCAAGTCAGGG - Intergenic
933449872 2:82434674-82434696 GATGTGTAATGGTCAAATCAGGG - Intergenic
933562499 2:83906106-83906128 AATGTATCATGATCAAGTCAGGG + Intergenic
933722096 2:85404135-85404157 ATTGTATAATGATCAAATCAAGG - Intronic
933851933 2:86374928-86374950 AATGTATAATGATCAAATCAGGG + Intergenic
934020223 2:87942542-87942564 AATGTGTAATGATCAAATCAGGG + Intergenic
934301342 2:91778232-91778254 AGTGTATAATGATCAAAGCAGGG + Intergenic
934874353 2:97902008-97902030 ACTGTGTAATGATCAAATCAGGG - Intronic
935015434 2:99177491-99177513 ATTGTGTAATGATCAAATCAGGG + Intronic
935029189 2:99305809-99305831 GTTGTGTAATGATCAAATCAGGG - Intronic
935036491 2:99380361-99380383 TTTGTATTATTATGAACTCATGG + Intronic
935068405 2:99672970-99672992 AATGTGTAATGATCAAATCAGGG - Intronic
935290582 2:101607568-101607590 GTTGTATAATGATCAAGTCAGGG - Intergenic
935358227 2:102224786-102224808 AATGTGTAATGATCAAATCAGGG - Intronic
935508637 2:103940699-103940721 AATGTGTAATGATCAAATCAGGG - Intergenic
935518552 2:104076673-104076695 CTTATATAATGATCACATCAGGG - Intergenic
935703086 2:105830031-105830053 AGTGTGTAATGATCAAATCAGGG + Intronic
935891192 2:107680412-107680434 GTTGTAAAATGTTCAAAACAAGG + Intergenic
935977118 2:108589275-108589297 ATTGTACAATGACCAAATCAGGG + Intronic
936050790 2:109222399-109222421 AATGTGTAATGATCAAATCAGGG - Intronic
936242859 2:110802933-110802955 ATTGTATAATAATAAAATCAGGG - Intronic
936342344 2:111645212-111645234 GTTATATTGAGATCAAAGCAGGG + Intergenic
936490448 2:112966845-112966867 ATAGTATAATGATCAAATCTAGG + Intergenic
936631652 2:114209651-114209673 AATGTATAATGATCTAATCAGGG - Intergenic
936663496 2:114568232-114568254 AATGTATGATGATCAAGTCAGGG + Intronic
936766370 2:115853769-115853791 AATGCATAATGATCAAATCAGGG + Intergenic
937109619 2:119354069-119354091 GTTGTAGAATGAGCAAATCAGGG - Intronic
937444482 2:121945926-121945948 GTTGTACAAGGATCAAATCAGGG + Intergenic
937504437 2:122520628-122520650 GCTGTGTAATGATTAAATCAGGG - Intergenic
937511262 2:122598013-122598035 ATTATATAATGCTCAAATCAGGG - Intergenic
937534610 2:122870502-122870524 GTTGTATGCTGATCAAATCAGGG - Intergenic
937677416 2:124607440-124607462 GTTGTTTTATAATCTAATCTTGG + Intronic
937752393 2:125492240-125492262 ATTGTGTAATGATCAATTCAGGG + Intergenic
937922620 2:127142027-127142049 ATTGTATCATGATCAAGTCAGGG + Intergenic
938225488 2:129612442-129612464 AATGTTTAATGATCAAATCATGG - Intergenic
938225890 2:129616012-129616034 ATTGTGTAATGATCAAATCAGGG - Intergenic
938235271 2:129700870-129700892 ATTGTGCTATCATCAAATCAGGG + Intergenic
938252436 2:129826354-129826376 AATGTGTAATGATCAAATCAGGG - Intergenic
938253019 2:129830771-129830793 ATTGTATACTGATCAAATTAGGG - Intergenic
938483963 2:131684358-131684380 ATTGGGTAATGATCAAATCAGGG + Intergenic
938597171 2:132799846-132799868 AATGTATAATGATCCAATCAGGG + Intronic
938939824 2:136160316-136160338 AATGTGTAATGATCAAATCAAGG + Intergenic
939142669 2:138374404-138374426 ATTGTATAATAATCAAATCAGGG - Intergenic
939200392 2:139026833-139026855 AATGTATAATGAGCAAATCAGGG + Intergenic
939355606 2:141098041-141098063 TTTTTATTATGATCATTTCAAGG - Intronic
939482573 2:142767910-142767932 GATGTGTAATGATCAAGTCAGGG - Intergenic
939518627 2:143201436-143201458 AATGTATAATAATCAAATCAGGG + Intronic
939655741 2:144821988-144822010 AATGTGTAATGATCAAATCAGGG - Intergenic
939780862 2:146445997-146446019 TTTGTATAATGATCAAACCAGGG + Intergenic
939833264 2:147097831-147097853 AATATATAATGATCAAATCAGGG + Intergenic
939928797 2:148206400-148206422 AGTGAATAATGATCAAATCAGGG + Intronic
940064205 2:149608464-149608486 AATGTGTAATGATCAAATCAGGG - Intergenic
940199680 2:151136785-151136807 AATATATAATGATCAAATCAGGG + Intergenic
940492330 2:154378743-154378765 GTTGTATAATGATCAAATCAGGG - Intronic
940517068 2:154696827-154696849 GTTGGAAAATCATCAAATCATGG - Intergenic
940567979 2:155392809-155392831 AATGTGTAATGATCAAATCAGGG + Intergenic
940616590 2:156056280-156056302 TTTCTATTTTGATTAAATCAAGG + Intergenic
940631190 2:156241432-156241454 AATGTATAATGATCAAATCAAGG + Intergenic
940669211 2:156647123-156647145 TTTGTATAATGATTAAATCAGGG - Intergenic
941099008 2:161276589-161276611 AATGTGTAATGATCAAATCAGGG + Intergenic
941129884 2:161634642-161634664 GTTGTATAATAATCAAATAAGGG + Intronic
941829609 2:169940089-169940111 AATGTGTAATGATCAAATCAGGG + Intronic
941831683 2:169968141-169968163 GGTGTGTAATGATCAAATCAGGG + Intronic
941913065 2:170785181-170785203 AATGTGTAATGATCAAATCAAGG - Intronic
942173166 2:173307049-173307071 GTTGTCTAATGATCAAATCAGGG - Intergenic
942289514 2:174455117-174455139 ATTGTGTAATGATCAAATCAGGG - Intronic
942309171 2:174638334-174638356 ATTGTATAATGATCCAATCAGGG + Intronic
942538725 2:176993277-176993299 AATGTGTAATGATCAAATCAGGG - Intergenic
942558017 2:177191408-177191430 CTTGTATAATGATCAAATCAGGG - Intergenic
943211025 2:184966213-184966235 ATTGTGTAATAATCAAATCAGGG + Intergenic
943250118 2:185509593-185509615 ATTCTATAATGATCAAATAAAGG + Intergenic
943253764 2:185566709-185566731 TATGTGTAATGATCAAATCAGGG - Intergenic
943256337 2:185598285-185598307 AATGTATAATGATCAAATCAGGG - Intergenic
943375420 2:187070833-187070855 CTTGTGTGATGATGAAATCAGGG + Intergenic
943476187 2:188358548-188358570 TATGTGTAATGATCAAATCAGGG - Intronic
943744381 2:191446162-191446184 TTTATATTATCATGAAATCATGG - Intergenic
943820860 2:192319073-192319095 GTTGTATTTTGGTCAAAACAAGG + Intergenic
943977045 2:194496014-194496036 GTTGTATAATGATCCAATTAGGG + Intergenic
944048836 2:195443292-195443314 ATTGTGTAATGATCAAATCAGGG - Intergenic
944090248 2:195900857-195900879 GATGTGTAATGATCAAATCAGGG - Intronic
944367413 2:198939151-198939173 AATGTGTAATGATCAAATCAGGG + Intergenic
944486723 2:200214498-200214520 GTTTTATTATGGTCATATGAGGG - Intergenic
944590332 2:201211020-201211042 GTTGTATAATGATCAAATCAGGG + Intronic
944611026 2:201407920-201407942 AATGTATAATGATCAAATTAGGG + Intronic
944746604 2:202662899-202662921 ACTGTATAATAATCAAATCAGGG - Intronic
944890028 2:204108209-204108231 AATGTGTAATGATCAAATCAGGG - Intergenic
944919016 2:204390979-204391001 AATGTGTAATGATCAAATCAGGG + Intergenic
945269156 2:207921442-207921464 AATGTATAATAATCAAATCAGGG + Intronic
945363005 2:208914471-208914493 AATGTATAATGATCAAATCAGGG - Intergenic
945401119 2:209384263-209384285 AATGTATAATAATCAAATCAGGG - Intergenic
945445168 2:209928610-209928632 AATGTGTAATGATCAAATCATGG + Intronic
945461330 2:210112691-210112713 GATGTATAGTGATCAGATCAGGG + Intronic
946042555 2:216795184-216795206 AATGTGTAATGATCAAATCAGGG - Intergenic
946520326 2:220457524-220457546 AATGTGTAATGATCAAATCAGGG - Intergenic
946905210 2:224409054-224409076 AATGTGTAATGATCAAATCAGGG - Intergenic
946935717 2:224718401-224718423 AATGTATAATGAGCAAATCAGGG + Intergenic
947007767 2:225531765-225531787 GCTGTATTATAAACAAAGCAGGG - Intronic
947040050 2:225907898-225907920 GATATATAATGATCAAATCTGGG + Intergenic
947645683 2:231737742-231737764 GTTGTATTGTGATATGATCATGG - Intronic
947880637 2:233507893-233507915 GTTGTATAATGATTAAATCAGGG - Intronic
948341878 2:237259701-237259723 AATGTATAGTGATCAAATCAGGG - Intergenic
948539081 2:238673850-238673872 AATGTGTAATGATCAAATCAGGG + Intergenic
948559539 2:238842421-238842443 GATGTGTAACGATCAAATCAGGG + Intergenic
948583860 2:239006195-239006217 GTGGTATAATAATCAAATCAGGG + Intergenic
948713557 2:239841749-239841771 GTTGTATAATGATTCAATCAGGG + Intergenic
1168732160 20:94196-94218 AATGTGTAATGATCAAATCAGGG + Intronic
1168747446 20:255601-255623 AATGTGTAATGATCAAATCAGGG - Intergenic
1168945698 20:1755235-1755257 GAAGTATAATGATCAAATCAGGG - Intergenic
1169055547 20:2617661-2617683 AATATATAATGATCAAATCAGGG + Intronic
1169239084 20:3959544-3959566 AACGTATAATGATCAAATCAGGG + Intronic
1169240804 20:3978451-3978473 AATGTATAATGATTAAATCATGG - Intronic
1169320459 20:4628692-4628714 ATTGTGTGATGATCAAATCAGGG - Intergenic
1169505391 20:6205937-6205959 AGTGTATAGTGATCAAATCAGGG + Intergenic
1169524698 20:6411277-6411299 AATGTATAATGATAAAATCAGGG - Intergenic
1169836077 20:9880624-9880646 GATGTGTAATGATCAAATCAGGG + Intergenic
1169855599 20:10099039-10099061 AATGTGTAATGATCAAATCAAGG - Intergenic
1170170782 20:13409758-13409780 AATGTGTTATGATCAAGTCAGGG + Intronic
1170315592 20:15037994-15038016 AGTGTATAATAATCAAATCAGGG - Intronic
1170334994 20:15260064-15260086 AATGTATAATGATCAAATAAAGG + Intronic
1170377763 20:15719729-15719751 ATTGTGTAATGATCAAATCAGGG + Intronic
1170609175 20:17897881-17897903 ATTGTATAATGGTCAAATTAGGG - Intergenic
1170886629 20:20345316-20345338 AATGTGTAATGATCAAATCAGGG - Intronic
1171021451 20:21587835-21587857 CTTGTGTAATGATCAAATCAGGG + Intergenic
1171330738 20:24336702-24336724 ATTGTGTAATGATCAAATCAGGG - Intergenic
1171811218 20:29745271-29745293 GTTGTATTATGTTCTTCTCAGGG - Intergenic
1171943977 20:31359499-31359521 ATTGTATAATGATAAAATTAGGG - Intergenic
1172072912 20:32271879-32271901 GTTTTATTATGATCTCATCCAGG - Intergenic
1172088001 20:32403949-32403971 AGTGTATAATGATCAAAGCAAGG + Intronic
1172984825 20:38976529-38976551 GTTGTATAATGATCAAATCTGGG + Intronic
1173299278 20:41786651-41786673 ATTGCATAATGATGAAATCAGGG + Intergenic
1173642140 20:44610941-44610963 GTTGTATAATAATCAGATCAGGG + Intronic
1173941079 20:46911991-46912013 AATGTGTGATGATCAAATCAGGG - Intronic
1173960464 20:47067504-47067526 AATGTGTAATGATCAAATCAGGG - Intronic
1175701746 20:61143129-61143151 AATGTGTGATGATCAAATCAGGG + Intergenic
1176685254 21:9842283-9842305 AATGCATAATGATCAAATCAGGG - Intergenic
1176714651 21:10340805-10340827 ATTGGGTAATGATCAAATCAGGG - Intergenic
1176733693 21:10522802-10522824 ATTGCATAATGATCAAATCATGG + Intronic
1177060044 21:16361193-16361215 AGTGTATAATGATCAGATCAGGG - Intergenic
1177129317 21:17237167-17237189 AATGTGTAATGATCAAATCAGGG - Intergenic
1177222751 21:18216210-18216232 GAAGTATAATGATTAAATCAGGG + Intronic
1177246246 21:18527822-18527844 AATGTATAGTGATCAAATCAGGG + Intergenic
1177344403 21:19851450-19851472 AATGTGTAATGATCAAATCAGGG - Intergenic
1177399242 21:20580836-20580858 ATTGAAGTATGATAAAATCAAGG + Intergenic
1177421058 21:20857889-20857911 AATGTGTAATGATCAAATCAGGG - Intergenic
1177484168 21:21734422-21734444 ATTGTATAATGATCAAATCAGGG - Intergenic
1177509180 21:22061183-22061205 GATGTATAATGATCAATTCAGGG - Intergenic
1177862380 21:26469560-26469582 AATGTATAATAATCAAATCAGGG + Intronic
1177887926 21:26768208-26768230 AATGTGTAATGATCAAATCAGGG + Intergenic
1177938849 21:27383872-27383894 AGTGTATAATGATCAAATCAGGG - Intergenic
1178158656 21:29885150-29885172 ATTGTATAATGATCAAATCAGGG + Intronic
1178198517 21:30376080-30376102 GATGTGTAATGATCAAATCTGGG + Intronic
1178225552 21:30713588-30713610 TATGTGTAATGATCAAATCAGGG - Intergenic
1178243945 21:30934583-30934605 ATTGTGTAATGATCAAATCAAGG - Intergenic
1178560147 21:33631196-33631218 ATTATGTAATGATCAAATCAGGG - Intronic
1178596703 21:33960801-33960823 AATGTATAATGATCCAATCAGGG - Intergenic
1178853872 21:36234914-36234936 ATTGTATGATGATCAAATCATGG + Intronic
1179206503 21:39285528-39285550 ATTGTATAAGGATCAAATGAGGG - Intronic
1179263687 21:39782657-39782679 AATGTATAATGATCAAATCAGGG + Intronic
1180341880 22:11626641-11626663 GCTGTATTATGATCTTCTCAGGG + Intergenic
1180479720 22:15740110-15740132 GGTGAATTATGATCAAACCACGG - Intergenic
1180485054 22:15786813-15786835 GTTGGGTAATGATCAAATCAGGG + Intergenic
1180561444 22:16618274-16618296 ATTGCATAATGATCAAATCGTGG + Intergenic
1180569961 22:16705237-16705259 AGTGTGTAATGATCAAATCAGGG - Intergenic
1180744896 22:18080711-18080733 GTTGTATAATGATCAAATCAGGG + Intronic
1180862814 22:19096512-19096534 AATGTGTAATGATCAAATCATGG - Intronic
1181186151 22:21105771-21105793 TTTGAGTAATGATCAAATCAGGG + Intergenic
1181331306 22:22093983-22094005 GTAGTGTCATGATCAAATCATGG - Intergenic
1181562158 22:23711742-23711764 ATTGTGTAATGATGAAATCAGGG - Intergenic
1181843357 22:25684980-25685002 GTTGTATAATGATCTAATCAGGG - Intronic
1182378668 22:29868590-29868612 ATTGTAGAATGATCAAATCAGGG - Intergenic
1183030162 22:35097795-35097817 ATTGTGTACTGATCAAATCAGGG + Intergenic
1183534215 22:38386740-38386762 ATTGCATAATGATCAAATCATGG - Intronic
1183664289 22:39238440-39238462 GTGGTATTATTACCAAATCCGGG - Intronic
1184305558 22:43598871-43598893 AATGTGTAATGATCAAATCAGGG - Intronic
1184518238 22:44976248-44976270 ATTGTGTAATCATCAAATCAAGG + Intronic
1185123840 22:48992897-48992919 CTTGTATACGGATCAAATCAGGG - Intergenic
1203293334 22_KI270736v1_random:16812-16834 AATGTGTAATGATCAAATCAGGG - Intergenic
949090531 3:22954-22976 AATGCATAATGATCAAATCAGGG - Intergenic
949144324 3:678536-678558 AATGTGTAATGATCAAATCAGGG + Intergenic
949308968 3:2674346-2674368 AATGTACAATGATCAAATCAGGG + Intronic
949644341 3:6075984-6076006 AATGTGTAATGATCAAATCAGGG + Intergenic
949680716 3:6511494-6511516 GTTGTGTAATGATCAAATTAGGG + Intergenic
949860405 3:8500103-8500125 AATGTGTAATGATCAAATCAGGG - Intergenic
949922928 3:9017785-9017807 AATGTATAATGATCAAGTCAGGG + Intronic
950200965 3:11043718-11043740 AATGTATAACGATCAAATCAGGG + Intergenic
950347868 3:12314896-12314918 AATGTGTAATGATCAAATCAGGG + Intronic
950951131 3:17000379-17000401 AATGTAAAATGATCAAATCAGGG + Intronic
950981995 3:17316854-17316876 CCAGTCTTATGATCAAATCAGGG - Intronic
951192283 3:19785096-19785118 AATGTGTAATGATCAAATCAGGG - Intergenic
951348583 3:21576938-21576960 GATGTCTAATGATCAAATCATGG + Intronic
951395093 3:22155112-22155134 AATGTGTAATGATCAAATCAGGG - Intronic
951562943 3:23986473-23986495 AATGTATAATGATCAAATCAGGG - Intergenic
951679175 3:25276350-25276372 ATTGTATAATGATCAAATCAGGG - Intronic
951854775 3:27183135-27183157 AATGTTTAATGATCAAATCAGGG - Intronic
952048383 3:29352521-29352543 AGTGTATAAAGATCAAATCAAGG + Intronic
952137969 3:30445114-30445136 AATGTGTAATGATCAAATCAGGG - Intergenic
952178501 3:30893334-30893356 ATTGTTTAATGACCAAATCAGGG + Intronic
952231736 3:31438145-31438167 GATGTGTTATGATCAAACCAGGG - Intergenic
952496608 3:33921426-33921448 AATGTGTCATGATCAAATCAGGG - Intergenic
952566463 3:34665224-34665246 ATTGTGTAATGATCAAGTCATGG + Intergenic
952675174 3:36021261-36021283 AATGTCTAATGATCAAATCAGGG - Intergenic
952676259 3:36034319-36034341 ATTGTGTAATGATCTAATCAAGG + Intergenic
953111338 3:39942586-39942608 AATGTGTAATGATCAAATCAGGG + Intronic
953274644 3:41482945-41482967 GATGTATAATAATCACATCAGGG + Intronic
953280834 3:41554758-41554780 AATGTGTAATGATCAAATCAGGG - Intronic
953594194 3:44292720-44292742 GATGTATAATGATCAAATCAGGG + Intronic
953731240 3:45450174-45450196 AGTGTGTCATGATCAAATCAGGG + Intronic
953836823 3:46353528-46353550 ATTGTGCAATGATCAAATCAGGG - Intergenic
954477838 3:50765695-50765717 ATTGTGTAATGATCAAATCAGGG + Intronic
954507216 3:51088473-51088495 AATGTATAATTATCAAATCAGGG - Intronic
955311410 3:57891423-57891445 AATGTATAAAGATCAAATCAGGG + Intronic
955556618 3:60144675-60144697 GTTGTGTAATGATCCAATCAGGG + Intronic
955898806 3:63729612-63729634 AGTGTATAATGATCAAGTCAAGG - Intergenic
956007447 3:64796126-64796148 AGTGTGTAATGATCAAATCAGGG - Intergenic
956221574 3:66909617-66909639 AGTGTGTAATGATCAAATCAAGG - Intergenic
956854689 3:73264199-73264221 AATGTGTAATGATCAAATCAAGG + Intergenic
957030861 3:75239169-75239191 AATGCATAATGATCAAATCAGGG - Intergenic
957067352 3:75536347-75536369 AATGTGTAATGATCAAATCAGGG - Intergenic
957182220 3:76893597-76893619 TATGTATAATGATCAAGTCAGGG + Intronic
957185212 3:76932723-76932745 GTTGTATTATGAGGAAGACATGG + Intronic
957372299 3:79310683-79310705 AATGTGTAATGATCAAATCAGGG - Intronic
957375776 3:79355346-79355368 ATGGTAGAATGATCAAATCAGGG + Intronic
957713862 3:83899892-83899914 AATGTGTTATGATCAAATCAGGG + Intergenic
957812343 3:85240915-85240937 AATGCATGATGATCAAATCAGGG + Intronic
957852606 3:85829364-85829386 GATGTGTAATGATCAAATGAGGG + Intronic
957877213 3:86163136-86163158 GATGTGTAAGGATCAAATCAGGG - Intergenic
957941359 3:87008732-87008754 AATGTATAATGATCAAATCAGGG + Intergenic
958014395 3:87921509-87921531 AATGTGTAATGATCAAATCAAGG + Intergenic
958051714 3:88356022-88356044 AATGTATAATGATCAAATAAAGG + Intergenic
958472747 3:94542043-94542065 AATGTATAATAATCAAATCAGGG + Intergenic
958558445 3:95709952-95709974 AATGTATAATGATCACATCAGGG - Intergenic
958719944 3:97831636-97831658 AATGTGTAATGATCAAATCAGGG + Intronic
958812874 3:98881961-98881983 GATGTATAGTGATCAGATCAGGG + Intronic
958909622 3:99979140-99979162 AGTGTGTAATGATCAAATCAGGG - Intronic
958909832 3:99981531-99981553 ACTGTGTGATGATCAAATCAGGG - Intronic
959103123 3:102036344-102036366 TTGGAATTATGACCAAATCAAGG - Intergenic
959363508 3:105426432-105426454 ATTTTGTAATGATCAAATCAGGG + Intronic
959693602 3:109225290-109225312 GATGTATAGTGATCAGATCAGGG + Intergenic
959778233 3:110196916-110196938 AATGTACAATGATCAAATCAGGG + Intergenic
959784503 3:110277439-110277461 AATGTATAATGATCAAATCAGGG + Intergenic
959884546 3:111483812-111483834 AATGTGTTATGATCAAACCAGGG - Intronic
959913496 3:111791751-111791773 TATGTGTAATGATCAAATCAGGG + Intronic
960400640 3:117193429-117193451 AATGTGTAATGATCAAATCAGGG - Intergenic
960458288 3:117900796-117900818 ATTGTATAATGATCAAATCAGGG - Intergenic
960607535 3:119522621-119522643 AATGTGTAATGATCAAATCAGGG - Intronic
960631891 3:119740742-119740764 GCTGTGTGATGATAAAATCAAGG - Intronic
960822703 3:121751069-121751091 AATGTGTAATGATCAAATCAGGG - Intergenic
960865901 3:122200277-122200299 AATGTGTAATGATCAAATCAGGG - Intronic
961221528 3:125204786-125204808 AATGTGTAATGATCAAATCAGGG - Intronic
961285794 3:125801624-125801646 AATGTGTAATGATCAAATCAGGG + Intergenic
961398861 3:126619772-126619794 AATGTGTAATGATCAAATCAGGG - Intronic
961728429 3:128949003-128949025 TTTGTATTGTTATCATATCATGG - Intronic
961900944 3:130211287-130211309 AATGTGTAATGATCAAATCAGGG - Intergenic
961929140 3:130515375-130515397 AATGTATAATGATCAAGTCAGGG + Intergenic
962018821 3:131474596-131474618 ATTGTATAATGATCAAATTAGGG - Intronic
962194575 3:133350493-133350515 ATTGTATAATGATCAAATCAGGG - Intronic
962299774 3:134228911-134228933 GCTGTATAATGATCCAGTCAGGG - Intronic
962495125 3:135932140-135932162 AATGTATAATGATCAAATCAGGG + Intergenic
962591691 3:136896069-136896091 GATGTGTAATGATCAAGTCAGGG + Intronic
962628086 3:137247449-137247471 GCTATATAATAATCAAATCAGGG + Intergenic
962628823 3:137255306-137255328 CTTGTGTAATGATCAAATCAGGG - Intergenic
962689790 3:137883014-137883036 ATTGTGTAACGATCAAATCAGGG - Intergenic
962899859 3:139752166-139752188 AATGTATAATAATCAAATCAGGG + Intergenic
963013100 3:140793695-140793717 ATTGTGTAATGATCAAATCAGGG - Intergenic
963089459 3:141469249-141469271 AATGTGTAATGATCAAATCATGG + Intergenic
963357541 3:144228712-144228734 AATGTGTAATGATCAAATCAGGG - Intergenic
963536350 3:146533830-146533852 GTTTTATTATCAACAAAACATGG - Intronic
963985949 3:151594830-151594852 AATGTGTAATGATCAAATCAGGG - Intergenic
964031955 3:152148474-152148496 GATGTATTAAGATCAAACAAGGG + Intergenic
964184032 3:153920904-153920926 GATGTGTAATGATCAAGTCAGGG - Intergenic
964236394 3:154535488-154535510 GTTGTATAATTATTTAATCAAGG - Intergenic
964334588 3:155641648-155641670 AATGTGTAATGATCAAATCAGGG - Intronic
964826243 3:160831247-160831269 CATGTATAATGATCAGATCAGGG - Intronic
964859354 3:161184010-161184032 ATTGTGTAATGATCAAATCAGGG - Intronic
964911338 3:161784891-161784913 AATGTGTAATGATCAAATCAAGG + Intergenic
965174269 3:165310509-165310531 AATGTATTATGATCAAATTAGGG - Intergenic
965241605 3:166207216-166207238 ATAGTATAATGATCAAATCGGGG + Intergenic
965418012 3:168421478-168421500 AATGTATTGTGATCAAATTAGGG + Intergenic
965442728 3:168735861-168735883 AATGTATAATGATCAAACCAGGG - Intergenic
965832749 3:172812667-172812689 ATCGTATAATGACCAAATCAGGG + Intronic
965832856 3:172814734-172814756 ATTGTGTGTTGATCAAATCAGGG + Intronic
965873664 3:173290606-173290628 GTTGTGTGATGCTCATATCAGGG + Intergenic
965931394 3:174047179-174047201 GGTGAATTATGATAAATTCATGG - Intronic
965979780 3:174673862-174673884 ATTGTGTAATGATCAAATAAGGG - Intronic
966198880 3:177340934-177340956 AATGTATAATAATCAAATCAGGG + Intergenic
966349345 3:179014115-179014137 AATGTGTAATGATCAAATCAGGG - Intergenic
966543019 3:181113164-181113186 AATGTATAATGATCACATCAGGG + Intergenic
966544462 3:181129804-181129826 AATATATAATGATCAAATCAGGG + Intergenic
966855638 3:184192218-184192240 AATGTGTAATGATCAAATCAGGG + Intronic
967354153 3:188549075-188549097 AATGTATATTGATCAAATCAGGG - Intronic
967483027 3:189996667-189996689 ATTGTATGATGATTAAATCAGGG - Intronic
967557872 3:190879181-190879203 ATAGTATAATGATCAAATTAGGG + Intronic
967565602 3:190967582-190967604 AATGTATAATAATCAAATCAGGG - Intergenic
967761762 3:193233907-193233929 ATTGTGTAATAATCAAATCAGGG + Intergenic
968256287 3:197275936-197275958 CATGTTTAATGATCAAATCAGGG - Intronic
968280061 3:197469825-197469847 AATGTGTAATGATCAAATCAGGG - Intergenic
969011941 4:4072912-4072934 AATGTGTAATGATCAAATCAGGG - Intergenic
969200876 4:5604755-5604777 GATGTATAATGGTCAAGTCAGGG - Intronic
969549139 4:7852763-7852785 GTTATATTCTTATCAAAACAAGG - Intronic
969631172 4:8338066-8338088 AATGTGTAATGATCAAATCAGGG + Intergenic
969742148 4:9036809-9036831 AATGTGTAATGATCAAATCAGGG + Intergenic
969801527 4:9569687-9569709 AATGTGTAATGATCAAATCAGGG + Intergenic
969996876 4:11322359-11322381 AATGTGTTATGAGCAAATCAAGG - Intergenic
970043737 4:11826059-11826081 AATGTATAATGATCAAATCATGG + Intergenic
970385011 4:15547243-15547265 AATGTATAATGATCAAATCAGGG + Intronic
970388782 4:15585693-15585715 ATTGTATAATGTTGAAATCAGGG - Intronic
970400245 4:15710367-15710389 ATTGTGTAATGATCAAATCAGGG + Intronic
970472346 4:16391538-16391560 ATTGCATTATGGTCAATTCATGG + Intergenic
970626960 4:17896658-17896680 ATTGTATAACGATCACATCAGGG + Intronic
970741492 4:19244097-19244119 ATTGTATAGTGATCCAATCAAGG + Intergenic
970743341 4:19264410-19264432 CATGTATAATGATCAAATCAGGG + Intergenic
970769153 4:19589416-19589438 AATGTGTGATGATCAAATCAGGG - Intergenic
971246768 4:24936490-24936512 ATAGTATCATGATCAAATCAAGG + Intronic
971468474 4:26991630-26991652 AATGTGTGATGATCAAATCAGGG - Intronic
971601250 4:28594944-28594966 AATGTATAATAATCAAATCAGGG - Intergenic
971604049 4:28634465-28634487 AGTGTATAGTGATCAAATCAGGG + Intergenic
971643731 4:29168782-29168804 GTTGTATAATGATTAAATAAGGG - Intergenic
971653643 4:29312072-29312094 ATTTTGTAATGATCAAATCAGGG + Intergenic
972017926 4:34269489-34269511 AATGTGTAATGATCAAATCAGGG - Intergenic
972049612 4:34712737-34712759 AATGTGTTATGATCAAATCAGGG - Intergenic
972206744 4:36782994-36783016 AATGTGTAATGATCAAATCAGGG - Intergenic
972258562 4:37384974-37384996 ATTGTGTAATGATCAAATCAGGG - Intronic
972273992 4:37539872-37539894 GTTGTAAAATGATCAAAACAGGG + Intronic
972469863 4:39393907-39393929 AATGTGTTATAATCAAATCAGGG - Intergenic
972519773 4:39842687-39842709 CATGTATAGTGATCAAATCAGGG - Intronic
972760625 4:42099954-42099976 ATTGTGTAATGATCAAATCAGGG + Intergenic
972857632 4:43126146-43126168 AATGTGTAATGATCAAATCAGGG - Intergenic
972893630 4:43591442-43591464 GTTGTATAATGATACAATCAAGG - Intergenic
973074727 4:45908845-45908867 GATGTGAAATGATCAAATCAGGG - Intergenic
973300662 4:48579924-48579946 ATTGTATAATGACCCAATCAGGG - Intronic
973726268 4:53779630-53779652 AGTGTATAATGATCAAATCAGGG + Intronic
973799833 4:54466354-54466376 ATTGTATAATGATCACATCAGGG + Intergenic
973967098 4:56174229-56174251 AATGTGTAATGATCAAATCAGGG + Intronic
974107093 4:57481888-57481910 ATTGTATAATGATCAAATTAGGG - Intergenic
974121380 4:57643032-57643054 AATATATAATGATCAAATCAGGG + Intergenic
974276904 4:59732939-59732961 ATTGTATAATGATCAAAACGAGG + Intergenic
974421873 4:61686573-61686595 GTTGTGTAATGATCAAATCAGGG + Intronic
974457790 4:62149965-62149987 ATTGTATAATGATCAAAGCATGG - Intergenic
974677197 4:65107874-65107896 ATTGTATAATGATCAAATCGGGG - Intergenic
974693698 4:65337154-65337176 AATATATAATGATCAAATCAGGG + Intronic
974728452 4:65828084-65828106 AGTGTGTAATGATCAAATCAGGG + Intergenic
974811547 4:66952745-66952767 AATGTGTAATGATCAAATCAGGG - Intergenic
974858427 4:67489552-67489574 AATGCATAATGATCAAATCAGGG + Intronic
974885757 4:67814995-67815017 AATGTATAATGATCAAATCTGGG + Intergenic
974939944 4:68454887-68454909 AATGTGTAATGATCAAATCAAGG + Intronic
975036473 4:69690310-69690332 AGTGTATAATGATCAAATAAGGG + Intergenic
975038583 4:69714601-69714623 AATGTGTAATGATCAAATCAGGG - Intergenic
975068808 4:70105938-70105960 ATTGTACAATAATCAAATCAGGG + Intergenic
975162500 4:71139777-71139799 AATGTGTAATGATCAAATCAGGG + Intergenic
975467534 4:74725137-74725159 GCTGTAACATGATTAAATCACGG - Intergenic
975467553 4:74725668-74725690 GTTGTTTTATGATCTAGTGAAGG - Intergenic
975504268 4:75121025-75121047 CATGTGTAATGATCAAATCAGGG - Intergenic
975504281 4:75121291-75121313 AATGTCTAATGATCAAATCAGGG - Intergenic
975561495 4:75712100-75712122 AATGTATAATGATCAAATTAGGG - Intronic
975656342 4:76644656-76644678 ATTGTGTAATAATCAAATCAGGG + Intronic
975709320 4:77143741-77143763 ATTGTATAATGGTGAAATCAGGG - Intergenic
975905185 4:79201982-79202004 ATTATATGATAATCAAATCAGGG + Intergenic
975920173 4:79377426-79377448 ATAGTATAATGATCAAATGAGGG - Intergenic
975994548 4:80299215-80299237 GTTATATAGTGATCAAATTAGGG + Intronic
976038205 4:80849924-80849946 ATTGTGTAATGATCAAATCTGGG - Intronic
976439561 4:85057875-85057897 ATTGTGTAATCATCAAATCAGGG + Intergenic
976471908 4:85438643-85438665 AATGTATAATGGTCAAATCAGGG + Intergenic
976498078 4:85753834-85753856 AATGTGTTATGATCAAATCAGGG + Intronic
976561841 4:86511093-86511115 AATGTGTAATGATCAAATCAGGG - Intronic
976666029 4:87593319-87593341 AGTGTGTAATGATCAAATCAGGG - Intergenic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
976805461 4:89041291-89041313 GCTGTGTAATGATCAAGTCAAGG - Intronic
976952108 4:90846501-90846523 AATGTTTAATGATCAAATCAAGG + Intronic
977037149 4:91968840-91968862 AATGTATAATGATCAAATCAGGG + Intergenic
977051751 4:92136938-92136960 AATGTGTAATGATCAAATCAGGG - Intergenic
977344640 4:95802356-95802378 AATGTCTAATGATCAAATCAGGG + Intergenic
977386934 4:96352760-96352782 AATGTGTAATGATCAAATCAGGG + Intergenic
977595051 4:98869771-98869793 AATGTGTAATGATCAAATCAGGG - Intergenic
977776371 4:100924779-100924801 ATTGTATAATGACCAAATCAGGG - Intergenic
977859433 4:101938509-101938531 ATTGTATAATAATCATATCAGGG - Intronic
977871907 4:102101390-102101412 GTAGCATAATGATCAAAACAAGG - Intergenic
977982894 4:103346490-103346512 ATTGTATAATGATAAAATCAGGG + Intergenic
978041396 4:104067919-104067941 AATGTATAATGATTAAATCAAGG + Intergenic
978085796 4:104651571-104651593 GTTGTATAATGATCCAATCAGGG - Intergenic
978197423 4:105987558-105987580 AATGTGTAATGATCAAATCAGGG + Intronic
978281048 4:107014701-107014723 ATCGTAAAATGATCAAATCAGGG - Intronic
978367748 4:108000228-108000250 AATGTGTAATGATCAAATCAGGG - Intronic
978414605 4:108462304-108462326 GTTGTGCTAAGCTCAAATCATGG - Intergenic
978664015 4:111161956-111161978 ATTGTATAATGATCAACTTAGGG - Intergenic
978847988 4:113297473-113297495 TAAGTATAATGATCAAATCAGGG - Intronic
978879064 4:113678543-113678565 AATGTATAATGATCAAATTAGGG + Intronic
979194841 4:117908172-117908194 ATAGTATAATGTTCAAATCAGGG + Intergenic
979312675 4:119222239-119222261 AGTGTATAATGATCAAATCAGGG + Intronic
979338472 4:119491366-119491388 ATAGCATAATGATCAAATCAGGG + Intergenic
979382517 4:120024547-120024569 CATGTATAATGATCAGATCAAGG - Intergenic
979472272 4:121113280-121113302 AATGTGTGATGATCAAATCAGGG - Intergenic
979498580 4:121412293-121412315 AGTGTGTAATGATCAAATCAGGG + Intergenic
979956340 4:126957558-126957580 GTTGTGTAATGATCTAATTATGG + Intergenic
980015021 4:127639698-127639720 ATTGTATAGTGATTAAATCAGGG + Intronic
980065564 4:128184496-128184518 AATGTGTAATGATCAAATCAGGG + Intronic
980109501 4:128621730-128621752 GATGTGTAATGATCAAGTCAAGG - Intergenic
980166251 4:129231487-129231509 GTTGTATAGTGATCCAATCAGGG - Intergenic
980169452 4:129271115-129271137 AATGTATAATGATCAAATCAAGG + Intergenic
980319331 4:131248447-131248469 TTAGTGTTATGATTAAATCAGGG - Intergenic
980427188 4:132641127-132641149 GATGTATAATTATCAAATCCAGG - Intergenic
980441377 4:132850190-132850212 CATGTGTAATGATCAAATCAGGG - Intergenic
980603198 4:135053064-135053086 TTTGTATTATAATCACTTCAGGG - Intergenic
980737528 4:136910795-136910817 ATTGTATAATGATCAAATCTGGG + Intergenic
980799195 4:137726983-137727005 ATTGTGTAATGATCAAATCAGGG + Intergenic
980996566 4:139785024-139785046 GTTGTGTGATGATGAAATCTGGG - Intronic
981232424 4:142372455-142372477 AATGTGTAATGATCAAATCAAGG - Intronic
981389720 4:144174349-144174371 AATGTGTAATGATCAAATCAGGG - Intergenic
981556063 4:145995979-145996001 AATGTATAATGATCAAATCAGGG + Intergenic
981591252 4:146364838-146364860 AATGTGTAATGATCAAATCAGGG - Intronic
981608408 4:146565257-146565279 AATGTATAATTATCAAATCAGGG - Intergenic
981622316 4:146715825-146715847 AATGTGTAATGATCAAATCAGGG - Intronic
981632708 4:146839396-146839418 AATGTATAATGCTCAAATCAAGG - Intronic
981721228 4:147803386-147803408 AATGTGTAATGATCAAATCAGGG + Intronic
981896551 4:149808607-149808629 AATGTGTAATGATCAAATCAAGG - Intergenic
981995696 4:150972500-150972522 AATGTATAATGATCAAGTCAGGG - Intronic
982046261 4:151449462-151449484 ATTGTATAATGTTCAAATTAGGG + Intronic
982103545 4:151991890-151991912 GTTGTATCATTTTTAAATCAAGG + Intergenic
982311536 4:153990485-153990507 GTTATGTAATGATCAAATCAGGG + Intergenic
982335122 4:154227798-154227820 AATGCATAATGATCAAATCAGGG + Intergenic
982362993 4:154543117-154543139 AGTGTGTAATGATCAAATCACGG - Intronic
982540871 4:156669044-156669066 AATGTGTAATGATCAAATCAGGG + Intergenic
982604685 4:157499686-157499708 AATGTATAATGATCAAATAAGGG - Intergenic
982629624 4:157815603-157815625 GATGTGTAATAATCAAATCAAGG - Intergenic
982688162 4:158517473-158517495 ATTTTATAATGTTCAAATCAGGG - Intronic
982705282 4:158702247-158702269 AATGTTTAATGATCAAATCAGGG + Intronic
982832375 4:160079250-160079272 AATGTGTAATGATCAAATCAGGG + Intergenic
982957309 4:161788189-161788211 ATTGTGTAATGATCAAATTAGGG + Intronic
982987205 4:162225248-162225270 ATTGTGTAATAATCAAATCAGGG + Intergenic
982989942 4:162260549-162260571 ACTGTGTAATGATCAAATCAGGG - Intergenic
983130801 4:164016864-164016886 TATGTATAATGATCAAATTAGGG - Intronic
983176923 4:164600181-164600203 GTCATATAATGATCATATCAGGG - Intergenic
983294449 4:165848396-165848418 AATGTATAATGATGAAATCAGGG - Intergenic
983377410 4:166947797-166947819 ATTGTTTAATGATCAAATAAGGG + Intronic
983857044 4:172659303-172659325 AGTGTGTAATGATCAAATCAAGG + Intronic
983876534 4:172883144-172883166 AATGCATAATGATCAAATCAGGG + Intronic
983910371 4:173232388-173232410 AGTGTGTAATGATCAAATCAGGG + Intronic
983970976 4:173873917-173873939 AATGTGTAATGATCAAATCAAGG - Intergenic
984025272 4:174535872-174535894 GTTGTATAATAATCAAATTAGGG - Intergenic
984201400 4:176725127-176725149 AATGTGTAATGATCAAATCAGGG - Intronic
984291493 4:177800769-177800791 CTTGTGTAATGATCAAATCAGGG + Intronic
984360721 4:178728072-178728094 AATGTGTTATGATCAAATCAAGG + Intergenic
984473302 4:180204431-180204453 AATGTGTAATGATCAAATCAGGG + Intergenic
984627202 4:182020605-182020627 AATGTATAGTGATCAAATCAGGG - Intergenic
984634762 4:182098882-182098904 AATGTGTAATGATCAAATCAGGG - Intergenic
984751038 4:183274852-183274874 ATTATATAATGATCAAATCAGGG + Intronic
984916419 4:184729174-184729196 GTTGTATAATGACCCAATCAGGG - Intronic
985167291 4:187110382-187110404 AATGTATAATGATCGAATCAGGG + Intergenic
985376281 4:189342711-189342733 GATGTATAATGATCATGTCAGGG + Intergenic
985860055 5:2463853-2463875 ATTGTGTAATGATCAAATCCAGG - Intergenic
985867710 5:2528328-2528350 ATTGTGTAATGATCAAATCAGGG - Intergenic
986074732 5:4324719-4324741 GTTATATAATGATCCAATTAGGG - Intergenic
986639358 5:9857361-9857383 AATGTATAATAATCAAATCAGGG - Intergenic
986750718 5:10785116-10785138 AGTGTGTAATGATCAAATCAGGG - Intergenic
986891061 5:12306245-12306267 AATGTACAATGATCAAATCAGGG - Intergenic
987146904 5:15000608-15000630 AATGTGTAATGATCAAATCAGGG - Intergenic
987151924 5:15050468-15050490 AATGTGTAATGATCAAATCAGGG + Intergenic
987211701 5:15690472-15690494 TTTGTATAATGATCAAATCAGGG + Intronic
987231984 5:15903666-15903688 AATGTATAATGATCAGATCAGGG - Intronic
987447558 5:18039304-18039326 GTTTTATTAAAATCAAATCCTGG + Intergenic
987501266 5:18712439-18712461 ATTGTATAATCATCAAATCATGG + Intergenic
987708005 5:21479806-21479828 AATGTGTAATGATCAAATCAGGG + Intergenic
987890658 5:23872826-23872848 AATGTATAATGCTCAAATCAAGG - Intergenic
988230218 5:28466952-28466974 GTTGTATAATGATCAAATCAGGG - Intergenic
988251896 5:28770006-28770028 TTTCTATAAGGATCAAATCAAGG + Intergenic
988271725 5:29026044-29026066 ATTGTATAATGATCAAAATAGGG - Intergenic
988481122 5:31631523-31631545 AATGTGTAATGATCAAATCAGGG - Intergenic
988704827 5:33715009-33715031 AATGTACAATGATCAAATCAGGG - Intronic
988734983 5:34011501-34011523 AATGTGTAATGATCAAATCAGGG - Intronic
988751775 5:34195149-34195171 AATGTGTAATGATCAAATCAGGG - Intergenic
988947112 5:36215371-36215393 AATGTATAATGATCAAATCAGGG + Intronic
989022508 5:37025723-37025745 AATGTATAATGATCAAATCAGGG - Intronic
989076802 5:37572497-37572519 ATTGTATTATGGTGAAGTCAGGG + Intronic
989081212 5:37623982-37624004 AATGTATAGTGATCAAATCAGGG + Intronic
989460199 5:41688768-41688790 GTTGTATAGTGATCCAATCAGGG + Intergenic
989500623 5:42162582-42162604 AATGTATAATGATCAAGTCAGGG + Intergenic
989618762 5:43364408-43364430 GTTGTATAATGATCAAATCAGGG - Intergenic
989753944 5:44928671-44928693 ATTGTATAATGAGCAAATCAGGG + Intergenic
989764419 5:45063445-45063467 ATTGTGTAATGATCAAATCAAGG - Intergenic
990039253 5:51359403-51359425 GATGTGTGATGATCAAATCAGGG + Intergenic
990133604 5:52618719-52618741 ATTGTATAATGATCATAACAGGG + Intergenic
990584200 5:57194462-57194484 AGTGTGTAATGATCAAATCAGGG + Intronic
990783194 5:59390051-59390073 AATGTGTGATGATCAAATCAGGG - Intronic
990843592 5:60111216-60111238 AATGTGTAATGATCAAATCAGGG - Intronic
991217600 5:64173413-64173435 GTTGTATGATGATTAAATCAAGG + Intronic
991627335 5:68617278-68617300 GATGTGTAATGATCAAATCAGGG - Intergenic
991648773 5:68830006-68830028 AATGTATAATGATCAAGTCAGGG + Intergenic
991737102 5:69637923-69637945 AATGTGTAATGATCAAATCAGGG - Intergenic
991739538 5:69655956-69655978 AATGTGTAATGATCAAATCAGGG - Intergenic
991757964 5:69897223-69897245 AATGTGTAATGATCAAATCAGGG + Intergenic
991788676 5:70217647-70217669 AATGTGTAATGATCAAATCAGGG - Intergenic
991791113 5:70235697-70235719 AATGTGTAATGATCAAATCAGGG - Intergenic
991813426 5:70492752-70492774 AATGTGTAATGATCAAATCAGGG - Intergenic
991816558 5:70514033-70514055 AATGTGTAATGATCAAATCAGGG - Intergenic
991818998 5:70532074-70532096 AATGTGTAATGATCAAATCAGGG - Intergenic
991837367 5:70773105-70773127 AATGTGTAATGATCAAATCAGGG + Intergenic
991881122 5:71218011-71218033 AATGTGTAATGATCAAATCAGGG - Intergenic
991883559 5:71236032-71236054 AATGTGTAATGATCAAATCAGGG - Intergenic
992258495 5:74946440-74946462 GATGTGTAATGATCAAATCAGGG - Intergenic
992346555 5:75884707-75884729 ATTGTATAAGGATCAAATCAGGG - Intergenic
992595651 5:78344855-78344877 AATGTATAATGATCAAATCAGGG + Intergenic
992786084 5:80171957-80171979 GTTATATAGTAATCAAATCAAGG - Intronic
992876119 5:81057620-81057642 ATTGTATCATGATAAAATCAGGG + Intronic
993076428 5:83237784-83237806 AATGTATAATGATCAAATCAGGG - Intronic
993195584 5:84740566-84740588 ATTGCATAATGATCACATCAGGG + Intergenic
993212438 5:84969780-84969802 GTTATATAATGATCCAATCAGGG - Intergenic
993239976 5:85369541-85369563 GTTGTGTAGTGATCAAATCAGGG - Intergenic
993487540 5:88504780-88504802 AATGTATGATGATCAAATCAGGG - Intergenic
993514805 5:88818151-88818173 AATGTATAGTGATCAAATCAGGG - Intronic
993534759 5:89068782-89068804 ATTGCATAATGATCAAATCAGGG + Intergenic
993558411 5:89371304-89371326 GTTGTATAATGATCCAACAAGGG - Intergenic
993994135 5:94700415-94700437 ATTGTATAATGATAAAATCATGG + Intronic
994024561 5:95067341-95067363 ATTGTGTAATGATCAAATCAGGG - Intronic
994026690 5:95092582-95092604 AATGTGTAATGATCAAATCAGGG - Intronic
994064262 5:95518242-95518264 AATGTATTGTGATCAGATCAGGG + Intronic
994077051 5:95665138-95665160 GTTATATAATGATCCAATCAGGG + Intronic
994200152 5:96965010-96965032 AGTGTGTAATGATCAAATCAGGG + Intronic
994250824 5:97534940-97534962 AATGTATAAAGATCAAATCAGGG + Intergenic
994303549 5:98175918-98175940 AATGTGTAATGATCAAATCAAGG + Intergenic
994420075 5:99520772-99520794 AATGTGTAATGATCAAATCAGGG + Intergenic
994436585 5:99742754-99742776 AATGTGTAATGATCAAATCAGGG + Intergenic
994487133 5:100394367-100394389 AATGTGTAATGATCAAATCAGGG - Intergenic
994493163 5:100474259-100474281 AATGTGTAATGATCAAATCAGGG + Intergenic
994508310 5:100670467-100670489 AATGTATGATGATGAAATCAGGG + Intergenic
994508976 5:100679233-100679255 GTTGTATACTGATCCAATCAGGG + Intergenic
994523404 5:100872266-100872288 ATTATATAATGATCAAATCAAGG + Intronic
994734197 5:103532325-103532347 GTTGTGTAATGATCCAATCAAGG - Intergenic
994868435 5:105311310-105311332 AATGTGTAATGATCAAATCAGGG - Intergenic
995101706 5:108317418-108317440 AATGTGTAATGATCAAATCAGGG - Intronic
995231977 5:109775979-109776001 AATGTATAATGATCAAATCAGGG + Intronic
995292546 5:110474193-110474215 GTTATATAATGATCAAATCAGGG - Intronic
995306768 5:110660763-110660785 AATGTTTAATGATCAAATCAGGG + Intronic
995615293 5:113955957-113955979 TGTGTATAATGATCAAATCAGGG + Intergenic
995829661 5:116341243-116341265 GTTGTATAATTATAAAATCAGGG - Intronic
995932499 5:117464821-117464843 AATGCATGATGATCAAATCAGGG + Intergenic
995953347 5:117743880-117743902 AATGTGTAATGATCAAATCAGGG + Intergenic
996173501 5:120325561-120325583 GTTGTGTGATGATCAAATCAGGG - Intergenic
996189483 5:120521579-120521601 ATTGTGCAATGATCAAATCAGGG + Intronic
996206927 5:120750740-120750762 AATGTATAATGATCAAATCTGGG + Intergenic
996209150 5:120783649-120783671 AATGTATTATGCTCAAATTAGGG + Intergenic
996254397 5:121380614-121380636 AATGTATAATGATCAAGTCAGGG - Intergenic
996462127 5:123757875-123757897 AATGTGTAATGATCAAATCAGGG + Intergenic
996759759 5:126975412-126975434 ATTGTACAAGGATCAAATCAGGG + Intronic
996835792 5:127790393-127790415 AATGTGTAATGATCAAATCAGGG + Intergenic
996853182 5:127975808-127975830 GTTGTTTAATGATCAAATCAGGG + Intergenic
996872603 5:128208252-128208274 AATGTGTAATGATCAAATCAGGG - Intergenic
996905906 5:128599575-128599597 AATGTATAATGATCAAATCAGGG - Intronic
996921595 5:128774234-128774256 GTTGTGTAATGGTCAAATCAGGG + Intronic
997012749 5:129898112-129898134 AATATATAATGATCAAATCAGGG + Intergenic
997046717 5:130328079-130328101 CGTGTGTCATGATCAAATCAGGG + Intergenic
997102508 5:130984343-130984365 AATGTATAGTGATCAAATCAGGG + Intergenic
997122730 5:131192477-131192499 TATGTGTGATGATCAAATCAGGG - Intronic
997887506 5:137643665-137643687 ATTGGGTGATGATCAAATCAGGG + Intronic
998260475 5:140627387-140627409 GTTGAACAATGATCATATCAAGG + Intergenic
998293949 5:140947039-140947061 ACTGTGTAATGATCAAATCAGGG - Intronic
998531887 5:142892751-142892773 AATGTGTAATGATCAAATCAAGG + Intronic
999105137 5:149063893-149063915 ATTGTGTAATGAACAAATCAAGG - Intergenic
999235875 5:150093705-150093727 ATTGTGTAATGATCACATCAGGG - Intronic
999484129 5:151977316-151977338 ACTATATAATGATCAAATCAGGG + Intergenic
999487255 5:152009425-152009447 AATGTGTAATGATCAAATCATGG + Intergenic
999706795 5:154280467-154280489 AATGTATAATGATCAAATTAGGG - Intronic
999874302 5:155785356-155785378 ATTGTGTAATGATTAAATCAGGG + Intergenic
1000107834 5:158077392-158077414 AATGTATAATGATCAAATCAGGG + Intergenic
1000141627 5:158410181-158410203 AATGTATAATGATCAAATCAGGG + Intergenic
1000427491 5:161109383-161109405 AGTGTGTAATGATCAAATCAGGG + Intergenic
1000533073 5:162447746-162447768 GTTGCATAATGATCAATTCAAGG + Intergenic
1000567815 5:162872484-162872506 ATTGTATGATGATCAATTCAGGG - Intergenic
1000629248 5:163573203-163573225 AATGTGTAATGATCAAATCAGGG + Intergenic
1000743834 5:165004956-165004978 ATTATATAATCATCAAATCAGGG - Intergenic
1000811480 5:165867694-165867716 AATGTATAATAATCAAATCAGGG - Intergenic
1000853396 5:166368670-166368692 GTTGTATAATGATCCAATCAGGG - Intergenic
1001974865 5:175989840-175989862 CATGTATAATGATCAGATCAGGG - Intronic
1002183959 5:177445506-177445528 CTTGTATTTTGCTCAAATGATGG + Intergenic
1002242568 5:177853940-177853962 CATGTATAATGATCAGATCAGGG + Intergenic
1002408800 5:179057567-179057589 GTTTTATTATTATTAAACCATGG + Intergenic
1002658704 5:180774644-180774666 ATTATGTAATGATCAAATCAGGG + Intergenic
1002733155 5:181357703-181357725 GTTATAGTATGACCACATCAAGG - Intergenic
1002751384 6:116405-116427 GTTATAGTATGACCACATCAAGG + Intergenic
1002857076 6:1047451-1047473 AATGTATAATGATCAAATCAGGG - Intergenic
1002867368 6:1133835-1133857 AATGTATAATGATCAAATCAGGG + Intergenic
1002943732 6:1741116-1741138 GTTGTATAATGATCCATTCAGGG + Intronic
1003010861 6:2426314-2426336 AATGTGTAATGATCAAATCAGGG + Intergenic
1003319786 6:5040706-5040728 AATGTATAATAATCAAATCAGGG - Intergenic
1003354372 6:5352847-5352869 ATTGTGTAATGATCAAATCAGGG + Intronic
1003841260 6:10122654-10122676 AATGTCTGATGATCAAATCAGGG - Intronic
1003859103 6:10305531-10305553 AATGTATAATGACCAAATCAGGG + Intergenic
1003884781 6:10511938-10511960 ATTGTGTAATGATCAAATCATGG - Intronic
1003927440 6:10889351-10889373 AGTGTGTAATGATCAAATCAGGG + Intronic
1003960072 6:11200581-11200603 AATGTTTTAGGATCAAATCATGG + Intronic
1004085129 6:12440004-12440026 GTTGTAAAATAATCAACTCAGGG + Intergenic
1004102175 6:12624902-12624924 GTTGTATAATGATCAAATCAGGG - Intergenic
1004330708 6:14718000-14718022 AATGTGTAATGATCAAATCAAGG - Intergenic
1004524576 6:16394489-16394511 ATTGTGTAATGATCAATTCACGG + Intronic
1004552265 6:16660046-16660068 GTTGTAGTATGTGCAAATGAAGG - Intronic
1004591760 6:17058876-17058898 GATGTATAATAATCACATCAGGG - Intergenic
1004617508 6:17304389-17304411 AATGTGTAATGATCAAATCAGGG - Intergenic
1004725906 6:18310966-18310988 ATTTTATAATGATCAATTCAGGG - Intergenic
1004764054 6:18704418-18704440 ATTGTGTAATGATCACATCATGG + Intergenic
1004887691 6:20067486-20067508 GTTGTATAATGATTAAATCAGGG + Intergenic
1004906425 6:20240513-20240535 GTTGTGTAATGATCAAATCAGGG + Intergenic
1005261093 6:24061373-24061395 AGTGTGTAATGATCAAATCAGGG + Intergenic
1005611941 6:27534511-27534533 ATTGTATAATGATCAAATCATGG - Intergenic
1005658840 6:27972460-27972482 ATTATATAATGATCAAATCAGGG - Intergenic
1006191032 6:32209551-32209573 AATGTATCATGATCAAATCAGGG - Intronic
1006254325 6:32817900-32817922 ATTGTGTATTGATCAAATCAGGG + Intronic
1006667151 6:35703480-35703502 AATGTATAATGATCAAATCAGGG - Intronic
1007190523 6:40012789-40012811 GATGTGTAAGGATCAAATCAGGG + Intergenic
1007843063 6:44732306-44732328 GTTGAAGTATGATAACATCAAGG + Intergenic
1007876005 6:45101702-45101724 AATGTATAATGATCATATCAGGG - Intronic
1008172621 6:48227816-48227838 ATTGTATAGTGATCAGATCATGG + Intergenic
1008193517 6:48489670-48489692 ATCGTATAATGATCAAATCAGGG - Intergenic
1008202605 6:48610101-48610123 AATGTGTAATGATCAAATCAGGG - Intergenic
1008245484 6:49166413-49166435 GTTTTATAATGATCAAATCAAGG + Intergenic
1008245489 6:49166539-49166561 GTTTTATAATGATCAAATCAAGG + Intergenic
1008310960 6:49973010-49973032 CATGTGTGATGATCAAATCAGGG + Intergenic
1008466045 6:51832026-51832048 GTTGTAAAATTAGCAAATCATGG - Intronic
1008693418 6:54006199-54006221 ACTGTGTAATGATCAAATCAGGG + Intronic
1008831221 6:55765013-55765035 AATGTGTAATGATCAAATCAGGG - Intronic
1009020198 6:57940732-57940754 AATGTGTAATGATCAAATCAGGG - Intergenic
1009266821 6:61566451-61566473 AATGTGTAATGATCAAATCAGGG - Intergenic
1009306268 6:62093418-62093440 GTTATGTAATGATCAAATCAGGG + Intronic
1009434431 6:63601643-63601665 AATGTATAATGATCAAATCAGGG + Intergenic
1009668575 6:66715170-66715192 GGTGTGTTCTGATCAAATCAGGG - Intergenic
1009731827 6:67618629-67618651 GTTGTGTAATGATCAATTCAGGG + Intergenic
1009748543 6:67852733-67852755 ATTGTGTAATGATAAAATCAGGG - Intergenic
1009894517 6:69731368-69731390 AATGTGTAATGATCAAATCAGGG - Intronic
1009901174 6:69809231-69809253 AATGTGTAATGATCAAATCAGGG + Intergenic
1010008334 6:71021404-71021426 GTTTTATAATGATCCAACCAGGG - Intergenic
1010012270 6:71061988-71062010 ATTGTATAATAATCAAATCAGGG + Intergenic
1010346941 6:74822397-74822419 AATGTATAATGATCAAATCAGGG - Intergenic
1010443393 6:75925169-75925191 ATTGTGCAATGATCAAATCAGGG - Intronic
1010566375 6:77419313-77419335 CAAGTATAATGATCAAATCAGGG - Intergenic
1010605352 6:77883234-77883256 GATCTGTAATGATCAAATCAAGG + Intronic
1010632473 6:78214946-78214968 ATTGTATAATTAACAAATCAGGG + Intergenic
1010753247 6:79638053-79638075 AATGTATAGTGATCAAATCAGGG + Intronic
1011115025 6:83880175-83880197 ATTGTGTAATGATCAAATCAGGG + Intronic
1011184508 6:84659321-84659343 GCTATATTATGATCCAAGCATGG + Intergenic
1011257224 6:85435116-85435138 AGTGTGTAATGATCAAATCAGGG + Intergenic
1011402931 6:86983723-86983745 GATGTATAATGATCAAATCTGGG - Intronic
1011446625 6:87448436-87448458 AATGTATTATGATCAAATCAGGG + Intronic
1011932174 6:92727492-92727514 AATGTGTAATGATCAAATCATGG + Intergenic
1012126634 6:95436823-95436845 AATGTGTAATGATCAAATCAGGG + Intergenic
1012180755 6:96149776-96149798 AGTGTGTAATGATCAAATCAGGG + Intronic
1012202303 6:96421866-96421888 AATGTATAATGATCAAATCAGGG + Intergenic
1012243529 6:96900663-96900685 GTTGAATTATGTTCAAAAGAAGG - Intergenic
1012336438 6:98064736-98064758 AATGTATAATGATCAAATCTGGG - Intergenic
1012486484 6:99727132-99727154 GTAGTATAACGATAAAATCAGGG + Intergenic
1012664398 6:101949280-101949302 TTTCTATTATAATCAAATCTAGG - Intronic
1012715170 6:102659927-102659949 GTTGTATAATGATCCAATCAGGG - Intergenic
1012748462 6:103124885-103124907 ATTGTGTAATTATCAAATCAAGG + Intergenic
1013050699 6:106532096-106532118 ATTGCATAATGATCAAATCAGGG + Intronic
1013097843 6:106962304-106962326 AATGTGTAATGATCAAATCAGGG - Intergenic
1013150015 6:107436781-107436803 AATGTATGATGATCAGATCAGGG - Intronic
1013340294 6:109207478-109207500 AGTGTATAATTATCAAATCAAGG + Intergenic
1013392160 6:109696948-109696970 ACTGTGTAATGATCAAATCAGGG - Intronic
1013563042 6:111325710-111325732 AATGTGTAATGATCAAATCAGGG + Intronic
1013651156 6:112196106-112196128 CATGTATAATGACCAAATCAGGG + Intronic
1013718504 6:112993289-112993311 GATGTATAATAATCAGATCAAGG - Intergenic
1014052568 6:116972494-116972516 ATTGTGTAATGGTCAAATCAGGG + Intergenic
1014404343 6:121030429-121030451 ATCGTATAATGATCAAATCAGGG - Intergenic
1014436661 6:121428037-121428059 AATGTGTAATGATCAAATCAGGG - Intergenic
1014478577 6:121906251-121906273 GTTATCTAATAATCAAATCAGGG + Intergenic
1014515311 6:122370582-122370604 AATGTGTAATGATCAAATCAGGG - Intergenic
1014608577 6:123511391-123511413 AATATATAATGATCAAATCAGGG - Intronic
1014617054 6:123615958-123615980 AATGTATAATGATCAAATCAGGG - Intronic
1014672002 6:124316182-124316204 AATGTGTAATGATCAAATCAGGG - Intronic
1014780695 6:125561280-125561302 AATGTGTAATGATCAAATCAGGG + Intergenic
1015155607 6:130092063-130092085 AATGTATAATGATCAAATCAGGG - Intronic
1015219341 6:130786177-130786199 AATGTATAATGATAAAATCATGG + Intergenic
1015375925 6:132510293-132510315 AATGTGTAATGATCAAATCAGGG - Intronic
1015504682 6:133970879-133970901 GTTGTATAGTGATCAAATCAGGG + Intronic
1015517837 6:134102057-134102079 AATGTGTAATGATCAAATCAGGG - Intergenic
1015594595 6:134854244-134854266 AATGCATAATGATCAAATCAGGG + Intergenic
1015605275 6:134948436-134948458 AATGTGTCATGATCAAATCAGGG - Intronic
1015606757 6:134964625-134964647 TTTGTATTATGCTCAAACTAAGG + Exonic
1015909265 6:138151152-138151174 AGTGTGTAATGATCAAATCATGG + Intergenic
1016103803 6:140136867-140136889 AATGTGTAATGATCAAATCAGGG - Intergenic
1016172509 6:141036959-141036981 AATGTGTAATGATCAAATCAAGG + Intergenic
1016178714 6:141116184-141116206 GTTGAATAATGTTAAAATCATGG + Intergenic
1016368811 6:143349311-143349333 GATGTATAATGATCAAATCAGGG + Intergenic
1016424714 6:143922252-143922274 AATGTGTAATGATCAAATCAGGG + Intronic
1016542917 6:145186569-145186591 ATTGTATAATAATCATATCAGGG - Intergenic
1016645561 6:146403891-146403913 CATGTGTAATGATCAAATCAGGG + Intronic
1016814511 6:148291275-148291297 CATGTGTAATGATCAAATCAGGG - Intronic
1017180058 6:151543385-151543407 AATGTATAATGATCAAATCAGGG + Intronic
1017288352 6:152704532-152704554 AATGTGTAATGATCAAATCAGGG + Intronic
1017289842 6:152723088-152723110 TTCTTATAATGATCAAATCAAGG - Exonic
1017339407 6:153302976-153302998 ATTGTGTAATGATCAAATTAGGG + Intergenic
1017557795 6:155591075-155591097 AGTGCATAATGATCAAATCAGGG + Intergenic
1017568881 6:155720413-155720435 ATTGTATAATGATAAAATCAGGG - Intergenic
1017990705 6:159486528-159486550 CATGTATAATTATCAAATCAGGG - Intergenic
1018087686 6:160318994-160319016 GTTGTATAAAGATCCAATCATGG + Intergenic
1018108537 6:160512534-160512556 ACTGTATAAGGATCAAATCAGGG + Intergenic
1018126475 6:160687617-160687639 AATGTATAGTGATCAAATCAGGG - Intergenic
1018134962 6:160770344-160770366 GTTGTGTAAGGATCAAATCAGGG - Intergenic
1018150011 6:160928928-160928950 AATGTATAGTGATCAAATCAGGG + Intergenic
1018508687 6:164500627-164500649 TTTGTATTATGATCATGTAAAGG - Intergenic
1018841449 6:167520086-167520108 AATGTACAATGATCAAATCAGGG + Intergenic
1018916733 6:168136927-168136949 ATTGTACAATGATCAAATCAGGG - Intergenic
1019092264 6:169548470-169548492 ACTTTATAATGATCAAATCAGGG - Intronic
1019124009 6:169827280-169827302 AGTGTATTGTGATGAAATCAGGG - Intergenic
1019227542 6:170526317-170526339 ATTGCATAATGATCAAGTCAGGG - Intergenic
1019237405 6:170630024-170630046 GTTATAGTATGACCATATCAAGG - Intergenic
1019470137 7:1215207-1215229 AGTGCATAATGATCAAATCAGGG + Intergenic
1020708068 7:11570547-11570569 AATGTATAATGATCAAAACAGGG - Intronic
1020739007 7:11989808-11989830 AATGTGTAATGATCAAATCAGGG - Intergenic
1020807650 7:12810014-12810036 AATGTATGATGATCAAATTAGGG + Intergenic
1020825987 7:13029117-13029139 AATGTGTAATGATCAAATCAGGG + Intergenic
1020839981 7:13204319-13204341 ATTCTGTGATGATCAAATCAAGG + Intergenic
1021381208 7:19968839-19968861 ATTGTGTAATCATCAAATCAAGG + Intergenic
1021445471 7:20729002-20729024 GATGTTTAATGATCAAATCAGGG + Intronic
1021506166 7:21387688-21387710 GATGTGTAATGATCAAATCAGGG - Intergenic
1021519196 7:21522271-21522293 ATTGTGTAATGATCAAATCAGGG - Intergenic
1021548010 7:21837889-21837911 ATTGTATAATGATCAAATCATGG - Intronic
1021591233 7:22265051-22265073 ATTGTATAATAATCAAATCAGGG + Intronic
1021726797 7:23555025-23555047 AATGTGTAATGATCAAATCAGGG + Intergenic
1021752379 7:23815727-23815749 GATGTGTAATAATCAAATCAGGG - Intronic
1021779775 7:24092048-24092070 ATTGTATAATGATCAAATCATGG + Intergenic
1021923736 7:25514327-25514349 ATTGTGCAATGATCAAATCAAGG - Intergenic
1022223856 7:28342834-28342856 ATTGTGTAATGATCAAATCAGGG + Intronic
1022279562 7:28892841-28892863 AATGTATAATGAGCAAATCAGGG - Intergenic
1022281565 7:28916111-28916133 GCTGTATAATGATCAAATCAGGG + Intergenic
1022318849 7:29268991-29269013 AATGTGTAATGATCAAATCAAGG + Intronic
1022332727 7:29396002-29396024 AATGTATAATGATCAAATCAGGG - Intronic
1022367319 7:29735871-29735893 AATGTGTAATGATCAAATCAGGG - Intergenic
1022544761 7:31175699-31175721 AATGTGTAATGATCAAATCAGGG - Intergenic
1022638233 7:32157388-32157410 AATGTACAATGATCAAATCAGGG - Intronic
1022651398 7:32279524-32279546 ATTGTATAATGATCAAATCAGGG - Intronic
1022899742 7:34794279-34794301 ATTGTGTAATGCTCAAATCAGGG - Intronic
1022968929 7:35499102-35499124 AATGTATAGTGATCAAATCAGGG - Intergenic
1023187103 7:37543601-37543623 AATGTGTAATGATCAAATCAGGG + Intergenic
1023345458 7:39266777-39266799 GTTGTATAATAGTCAAATCAGGG + Intronic
1023347050 7:39281231-39281253 ATTGCATCATGGTCAAATCAGGG + Intronic
1023462287 7:40411829-40411851 AATGTATAAAGATCAAATCAGGG - Intronic
1023529934 7:41142296-41142318 AATGTATAATTATCAAATCAGGG + Intergenic
1023729884 7:43180775-43180797 ATTGTTTAATGAACAAATCAGGG + Intronic
1024087612 7:45909305-45909327 ATTGTATAATAATCAAGTCAGGG - Intergenic
1024355373 7:48409047-48409069 GTTGTGTAATGATCAAATCAGGG + Intronic
1024586621 7:50847487-50847509 GATGCATAATGATCAAATGAGGG - Intergenic
1025038321 7:55616836-55616858 ATTGTATAATGATCAAATCAGGG + Intergenic
1026117704 7:67510000-67510022 AATGTGTAATGATCAAATCAGGG + Intergenic
1026300492 7:69093544-69093566 ATTGTGTAATGATCAAATTAAGG - Intergenic
1026636913 7:72091456-72091478 GATGTGTGATGATCAAATCAGGG - Intronic
1026670691 7:72388172-72388194 ATTGTGTATTGATCAAATCAGGG - Intronic
1027443912 7:78249904-78249926 GCTGTATAAGTATCAAATCAGGG - Intronic
1027551814 7:79607495-79607517 GTCATATAATGATCAAATCAGGG - Intergenic
1027643632 7:80769138-80769160 AATGTGTAATGATCAAATCAAGG + Intronic
1027680874 7:81220047-81220069 ATTGTATAATGATCAAATCAGGG + Intergenic
1027831183 7:83179730-83179752 GTTGTATAATAATCAAGTCAGGG + Intergenic
1027890564 7:83967868-83967890 ATTGTATAATGATCAAATCAGGG + Intronic
1028038168 7:86012225-86012247 AATGTATACTGATCAAATCAGGG + Intergenic
1028095227 7:86752352-86752374 TTTGTATTATACTCAAATTATGG - Intronic
1028225365 7:88245366-88245388 ATTGTGTGATTATCAAATCAGGG + Intergenic
1028247826 7:88503159-88503181 AATGTGTGATGATCAAATCAAGG + Intergenic
1028322869 7:89483237-89483259 AATGTATAATGATCAAGTCAGGG - Intergenic
1028334308 7:89632380-89632402 AATGTGTAATGATCAAATCAGGG + Intergenic
1028481696 7:91313514-91313536 GCTGCATTTTGATCAAATAATGG + Intergenic
1028765378 7:94551894-94551916 AATGCATAATGATCAAATCAAGG + Intronic
1028817969 7:95169590-95169612 ACTGTATAATGACCAAATCAGGG - Intronic
1028865144 7:95700876-95700898 ATTGTATAATGATTAAATCATGG + Intergenic
1029033943 7:97498791-97498813 AATGCATAATGATCAAATCAGGG - Intergenic
1029063080 7:97818803-97818825 AATGTGTAATGATCAAATCAGGG - Intergenic
1029107207 7:98187924-98187946 AGTGTGTGATGATCAAATCAGGG + Intronic
1029168282 7:98612169-98612191 AATGTATAATGATCAAATCAGGG + Intergenic
1029404206 7:100364477-100364499 GGTGAAGTATGATCACATCAAGG + Intronic
1029806025 7:102997354-102997376 AATGTGTAATGATCAAATCAGGG + Intronic
1029824972 7:103181704-103181726 AATGTGTAATGATCAAATCAGGG + Intergenic
1029994321 7:104991994-104992016 CATGTGTAATGATCAAATCAGGG - Intergenic
1030284074 7:107807148-107807170 AATGTGTAATGATCAAATCAGGG + Intergenic
1030286847 7:107835842-107835864 AATGTGTAATGATCAAATCAGGG + Intergenic
1030326712 7:108227393-108227415 ATTGTGTAATGATCAAATCATGG + Intronic
1030382867 7:108832909-108832931 AATGTATAATGATCAAATCAGGG + Intergenic
1030759745 7:113335811-113335833 ATTATATAATGATCAAATCAGGG - Intergenic
1030840487 7:114346937-114346959 GTTGTATACTGATACAATCAAGG - Intronic
1030954599 7:115836648-115836670 ATTGTGTCATGATCAAGTCAGGG - Intergenic
1031224898 7:119023621-119023643 ATTGTGTAATGATCAAATAAAGG - Intergenic
1031385461 7:121144742-121144764 AATGTGTAATGATCAAATCAGGG - Intronic
1031449846 7:121901785-121901807 GTTGTATAATGATCATATCAGGG + Intronic
1031538853 7:122968263-122968285 AATGTGTAATGATCAAATCAGGG - Intergenic
1031565103 7:123286588-123286610 AATGTATAATGATCAAGTCAAGG + Intergenic
1031566507 7:123304426-123304448 GATGTATAATGATCACATCAGGG - Intergenic
1031730418 7:125293349-125293371 ATTGTATAATGATCAAATCAGGG + Intergenic
1031801797 7:126256205-126256227 AATGTGTAATGATCAAATCAGGG - Intergenic
1031880967 7:127198146-127198168 AATGTATAATGATCAAATCATGG + Intronic
1032120893 7:129155444-129155466 AATGTTTAATGATCAAATCAGGG - Intronic
1032416578 7:131739823-131739845 AATGTGTAATGATCAAATCAGGG + Intergenic
1032618095 7:133497178-133497200 GTTTTACTATGCTGAAATCAAGG - Intronic
1032661605 7:133990061-133990083 AATGTATAATGATCAAATCAGGG + Intronic
1032679827 7:134170595-134170617 AATGTGTAATGATCAAATCAGGG - Intronic
1032930795 7:136667443-136667465 AATGTATAATGACCAAATCAGGG + Intergenic
1032962880 7:137060062-137060084 ATTGTATAACAATCAAATCAGGG + Intergenic
1033000644 7:137500801-137500823 AATGTATAATGATCAAACCAGGG + Intronic
1033008852 7:137597295-137597317 AATGTATAATGATCAAGTCAAGG - Intronic
1033146513 7:138875173-138875195 ACTGTGTGATGATCAAATCAGGG - Intronic
1033486728 7:141797108-141797130 AATGTATTGTGATCACATCAGGG + Intergenic
1033702178 7:143850654-143850676 ATTTTGTGATGATCAAATCAGGG - Intergenic
1033826901 7:145202256-145202278 GTTGTATAGTGGTGAAATCAGGG + Intergenic
1033886781 7:145959014-145959036 TTTGTATAATGATCAAATCAGGG + Intergenic
1034119361 7:148612923-148612945 AATGTGTAATGATCAAATCAGGG + Intronic
1034510417 7:151529838-151529860 AATGTGTAATGATCAAATCAGGG + Intergenic
1035462745 7:159054843-159054865 GTGGTATGATGATCCCATCAGGG + Intronic
1035510362 8:176587-176609 GTTATAGTATGACCACATCAAGG + Intergenic
1036015779 8:4782310-4782332 ATTGTGTTATGATCAAATCAAGG - Intronic
1036247345 8:7129360-7129382 AATGTGTAATGATCAAATCAGGG + Intergenic
1036253457 8:7185003-7185025 AATGTGTAATGATCAAATCAGGG - Intergenic
1036364036 8:8102475-8102497 AATGTGTAATGATCAAATCAGGG + Intergenic
1036412545 8:8515843-8515865 GATGCATAATGATCAAATTAGGG + Intergenic
1036894512 8:12622719-12622741 AATGTGTAATGATCAAATCAGGG - Intergenic
1037235613 8:16716100-16716122 GATGTGTAATGATCAAATCAGGG - Intergenic
1037296098 8:17402172-17402194 GTTGTGTAATAATCACATCATGG + Intronic
1037371177 8:18180712-18180734 GTTGTATAATGACCAAATAAGGG - Intronic
1037387546 8:18359515-18359537 ATTGTGTCATGATGAAATCATGG - Intergenic
1037390891 8:18390484-18390506 ATTGTGTAAAGATCAAATCATGG - Intergenic
1037455955 8:19064451-19064473 GATGTGTAATGATCAAATGAGGG + Intronic
1037519626 8:19667581-19667603 GATGAATTATGAACAAGTCAAGG + Intronic
1037621696 8:20568945-20568967 ATTGTATAATGATCAAATCAGGG + Intergenic
1038645413 8:29357464-29357486 ATTGTGTAATGATCAAATCAGGG + Intergenic
1038897270 8:31798269-31798291 AATGCATAATGATCAAATCAGGG - Intronic
1038938235 8:32275973-32275995 AGTGTGTAATGATCAAATCAGGG + Intronic
1039005677 8:33034341-33034363 AATGTGTAATGATCAAATCAAGG - Intergenic
1039042345 8:33419622-33419644 AATGTATAATGATCAAGTCAGGG - Intronic
1039086461 8:33784975-33784997 ATTGTATAATGATCAAATCAGGG - Intergenic
1039133399 8:34293387-34293409 GTAGTATAATGATCAAATTGAGG + Intergenic
1039236184 8:35505087-35505109 GATGTATAATAATCACATCAGGG - Intronic
1039269815 8:35868579-35868601 AGTGTATAATGATCAAATCCAGG + Intergenic
1039358445 8:36847292-36847314 AATGTATAATGATCAAATCGGGG + Intronic
1039457720 8:37718679-37718701 AATGTGTCATGATCAAATCAGGG - Intergenic
1039564264 8:38538844-38538866 AATGTATAATGATCAAATCAGGG + Intergenic
1039629642 8:39096153-39096175 AGTGTGTAATGATCAAATCAGGG + Intronic
1039636384 8:39171387-39171409 GATATGTAATGATCAAATCAGGG - Intronic
1039638187 8:39189544-39189566 CGTGTGTGATGATCAAATCAGGG + Intronic
1039639902 8:39207487-39207509 ATTGTATAATGATGAAATTAGGG + Intronic
1039687287 8:39817546-39817568 AATGTGTAATGATCAAATCAGGG - Intronic
1039698712 8:39940832-39940854 AATGTGTAATGATCAAATCAGGG - Intronic
1039735557 8:40328619-40328641 AATGTGTAATGATCAAATCAAGG - Intergenic
1040281071 8:46043977-46043999 AATGTATAAGGATCAAATCAGGG + Intergenic
1040642889 8:49360836-49360858 AATGTGTAATGATCAAATCATGG + Intergenic
1040716069 8:50254104-50254126 ATTGTATAATGATGAAATCAAGG - Intronic
1040740388 8:50567782-50567804 ATTGTATAATGATCAAATCTAGG + Intronic
1040771223 8:50978409-50978431 AATGTGTAATGATCAAATCAAGG + Intergenic
1040933455 8:52759554-52759576 GTTGTAATATGAGAAAAACATGG - Intergenic
1041103540 8:54419792-54419814 AATGTATTTTAATCAAATCAAGG - Intergenic
1041138283 8:54785011-54785033 ATTGTATAATGATCAAATCAGGG + Intergenic
1041485077 8:58367120-58367142 ATTATATGATAATCAAATCAGGG - Intergenic
1041607270 8:59796831-59796853 AATGTACAATGATCAAATCAGGG - Intergenic
1041654451 8:60335247-60335269 ATTGTGTAATGATCAAATCAGGG - Intergenic
1041876530 8:62694016-62694038 TGTATAATATGATCAAATCAGGG + Intronic
1042074878 8:64981480-64981502 TTTGTATAATAATCAAATCAAGG - Intergenic
1042273111 8:66975800-66975822 AATGTATAGTGATCAAATCAGGG + Intronic
1042355027 8:67818040-67818062 GCTGTATAATGATCAATTCAGGG + Intergenic
1042722128 8:71837591-71837613 AATGTGTAATGATCAAATCAGGG - Intronic
1042959023 8:74282867-74282889 AATGTGTAATGATCAAATCAGGG - Intronic
1042959315 8:74286351-74286373 ATTGCATGATGATCAAATCATGG + Intronic
1042986667 8:74591900-74591922 AATGTGTAATGATCAAATCAGGG + Intergenic
1043123302 8:76359089-76359111 AATGTATAATGATCAAGTCAGGG - Intergenic
1043205969 8:77440588-77440610 ATTGTGTTATGATTAAATCAGGG + Intergenic
1043274919 8:78380901-78380923 ACTGCATGATGATCAAATCAGGG - Intergenic
1043289145 8:78574196-78574218 ATTGTATAATGATCAAATCAGGG + Intronic
1043302525 8:78751697-78751719 AATGTGTAATGATCAAATCAGGG + Intronic
1043318713 8:78953990-78954012 TGTGTGTAATGATCAAATCAGGG - Intergenic
1043422554 8:80113852-80113874 AATGTGTAATGATCAAATCAGGG - Intronic
1043587852 8:81790378-81790400 GTTATATAATAATCAAAACAGGG + Intergenic
1043655875 8:82664080-82664102 AATGTATAATGATCGAATCAGGG - Intergenic
1043656074 8:82667863-82667885 AATGTATAATAATCAAATCAGGG + Intergenic
1043736875 8:83759196-83759218 GTTGTATAACAATTAAATCAAGG - Intergenic
1043744562 8:83857251-83857273 AATGTGTAATGATCAAATCATGG - Intergenic
1043861878 8:85327400-85327422 AATGTGTAATGATCAAATCAGGG - Intergenic
1044003290 8:86911526-86911548 TGTGTATAATAATCAAATCATGG + Intronic
1044036870 8:87315912-87315934 ATTGTGTAATGATCAAATCAAGG - Intronic
1044061152 8:87637475-87637497 GATGTATTATGTTCAAAATAGGG - Intergenic
1044082436 8:87902571-87902593 AATGTTTAATGATCAAATCATGG + Intergenic
1044143421 8:88683396-88683418 AATGTATAAAGATCAAATCAGGG + Intergenic
1044218695 8:89644520-89644542 AATGTGTAATGATCAAATCATGG - Intergenic
1044359491 8:91264824-91264846 ATTGAATAATGATCAAATCAAGG + Intronic
1044431664 8:92114619-92114641 AATGTGTAATGATCAAATCAGGG + Intergenic
1044510948 8:93077912-93077934 AATGTGTGATGATCAAATCAGGG - Intergenic
1044513805 8:93115230-93115252 CTTGTATTATTTTCAAATGAGGG + Intergenic
1044676979 8:94738941-94738963 AATGTATAATGATCAAATCAGGG + Intronic
1044739003 8:95306366-95306388 GTTGTAATATGATTATATCTTGG + Intergenic
1045143922 8:99317305-99317327 ATTGTGTAATGATTAAATCAGGG + Intronic
1045558955 8:103242187-103242209 AATGTCTAATGATCAAATCAGGG + Intergenic
1045800020 8:106091471-106091493 AATGTATAATGATCAAATCAGGG - Intergenic
1045803252 8:106126263-106126285 AATGTGTAATGATCAAATCAGGG - Intergenic
1046143474 8:110125337-110125359 GATTTGTAATGATCAAATCAAGG - Intergenic
1046215100 8:111134860-111134882 AATGTATAATAATCAAATCAGGG + Intergenic
1046261731 8:111777301-111777323 GTTGTATACTGATCAAATCAAGG + Intergenic
1046287147 8:112108954-112108976 AATGTATAATAATCAAATCAGGG - Intergenic
1046346340 8:112932896-112932918 AATGTGTAATGATCAAATCAGGG - Intronic
1046362720 8:113183771-113183793 AGTGTGTAATGATCAAATCAGGG + Intronic
1046472788 8:114700515-114700537 ATTGTATAATGATCACGTCAAGG + Intergenic
1046481773 8:114829232-114829254 ATTATATTATAATCAAATGAGGG + Intergenic
1046518806 8:115298488-115298510 AATGTGTAATGATCAAATCAAGG + Intergenic
1046570058 8:115951949-115951971 AATGTATAATGATAAAATCAGGG - Intergenic
1046599898 8:116304002-116304024 GATTTATTATGATCAATTAAGGG + Intergenic
1046767753 8:118088718-118088740 GTTTACTTTTGATCAAATCATGG + Intronic
1046889793 8:119410317-119410339 ATTACATCATGATCAAATCAGGG + Intergenic
1046909847 8:119613809-119613831 ATTGTATAATGATCAAATCAGGG + Intronic
1047087116 8:121530206-121530228 AATGTATAATGATCAAATTAAGG + Intergenic
1047117732 8:121863258-121863280 ATTGTGTAATGATCAAATCAGGG + Intergenic
1047318507 8:123755930-123755952 ATTGTGTCATGATTAAATCAGGG - Intergenic
1047400281 8:124540485-124540507 AATGTATAATGATCAAATCAGGG - Intronic
1047501865 8:125447870-125447892 TTTGTATAATGATTAAATCAGGG + Intergenic
1047509452 8:125505277-125505299 CAAGTATAATGATCAAATCAGGG + Intergenic
1047972670 8:130098718-130098740 AATGTGTAATGATCAAATCAGGG + Intronic
1047981609 8:130189097-130189119 AATGTATAATGATCGAATCAGGG + Intronic
1048091686 8:131248135-131248157 ATTGTGAAATGATCAAATCAGGG + Intergenic
1048108276 8:131437168-131437190 GTGGTGTAATTATCAAATCATGG - Intergenic
1048500694 8:134972163-134972185 AATATATAATGATCAAATCAGGG - Intergenic
1048644594 8:136405659-136405681 AATGTGTAATGATCAAATCAGGG - Intergenic
1048751962 8:137688157-137688179 GTTGTACAATGATCAAATCAGGG + Intergenic
1048761708 8:137802772-137802794 AATGTATAATCATCAAATCAAGG - Intergenic
1048891236 8:138949529-138949551 GTTGCAAAATGATCAAATCAGGG - Intergenic
1049861040 8:144899438-144899460 AATGTATAATGATCAAATCAGGG - Intronic
1049914939 9:308259-308281 AATGTGTAATGATCAAATCAGGG - Intronic
1049966292 9:783263-783285 ATTGTATAATGATCAAACCAGGG - Intergenic
1050242548 9:3652319-3652341 ATTGTGTAATGATCAAGTCAGGG + Intergenic
1050399297 9:5234199-5234221 AATGTGTAATGATCAAATCAGGG - Exonic
1050422273 9:5478029-5478051 ATTGTGTAATTATCAAATCAGGG + Intergenic
1050486826 9:6143142-6143164 TTTGTATTATGGTCATATCTAGG + Intergenic
1050635989 9:7613574-7613596 AATGTATAATGATCAAATCAGGG - Intergenic
1050701326 9:8342937-8342959 GTTGTAGTATGAACAAAGGACGG + Intronic
1050754793 9:8989149-8989171 AATGTGTAATGATCAAATCAGGG + Intronic
1050761607 9:9078988-9079010 GATGTATAGTGATCAGATCAGGG + Intronic
1050799456 9:9591745-9591767 ATTATGTAATGATCAAATCAGGG + Intronic
1050883823 9:10738817-10738839 AATGTGTAATGATCAAATCAAGG + Intergenic
1050980447 9:12005230-12005252 AATGTGTAATGATCAAATCAGGG + Intergenic
1051118291 9:13723055-13723077 GTTGTATAATTATCTAATTAGGG - Intergenic
1051131627 9:13867857-13867879 AATGTATTATGATCTAATGAGGG + Intergenic
1051178612 9:14386487-14386509 TTGGTATTATGATCAATTCTTGG - Intronic
1051302650 9:15669401-15669423 AATGTGTGATGATCAAATCAGGG + Intronic
1051323028 9:15930893-15930915 GTTGTATAATGATCCAGTCAGGG + Intronic
1051903620 9:22069594-22069616 GTTGTATAATAATCCAATCAAGG + Intergenic
1051908979 9:22131130-22131152 TTTTTATTATGATGAAAGCAAGG - Intergenic
1052255458 9:26450901-26450923 AATGTGTAATGATCAAATCAAGG + Intergenic
1052277234 9:26690888-26690910 ATTGTATAATGATCAACTCAGGG - Intergenic
1052400713 9:27996813-27996835 AATGTGTAATGATCAAATCAGGG - Intronic
1052842225 9:33302176-33302198 AATGTGTAATGATCAAATCAGGG + Intronic
1053333121 9:37235018-37235040 ACTGTATAATGATCAAATCAGGG + Intronic
1053515414 9:38726373-38726395 AATGTGTAATGATCAAATCAGGG - Intergenic
1053552292 9:39096484-39096506 AATGTGTAATGATCAAATCAGGG + Intronic
1053617057 9:39778845-39778867 AATGTATAATGATCAAATCAGGG + Intergenic
1053816419 9:41916644-41916666 AATGTGTAATGATCAAATCAGGG + Intronic
1053817798 9:41931256-41931278 AATGCATAATGATCAAATCAGGG + Intronic
1053875236 9:42538193-42538215 AATGTATAATGACCAAATCAGGG + Intergenic
1054106679 9:61060326-61060348 AATGTGTAATGATCAAATCAGGG + Intergenic
1054108051 9:61074925-61074947 AATGCATAATGATCAAATCAGGG + Intergenic
1054236461 9:62563535-62563557 AATGTATAATGACCAAATCAGGG - Intergenic
1054267111 9:62928592-62928614 AATGTATAATGATCAAATCAGGG - Intergenic
1054550601 9:66598037-66598059 AATGTATAATGATCAAATCAGGG - Intergenic
1054612806 9:67256200-67256222 AATGCATAATGATCAAATCAGGG - Intergenic
1054614178 9:67270799-67270821 AATGTGTAATGATCAAATCAGGG - Intergenic
1054733249 9:68722746-68722768 ACTGTGTAATGATCAAATCAGGG + Intronic
1054733487 9:68726186-68726208 GATGTATAATAATCACATCAAGG - Intronic
1054802590 9:69365451-69365473 ATCATATAATGATCAAATCAGGG + Intronic
1054988379 9:71289984-71290006 AATATATAATGATCAAATCAGGG - Intronic
1055413903 9:76062730-76062752 AATGTATGATGATCAAATAAGGG + Intronic
1055430874 9:76242157-76242179 GATGTGTGATGATCAAGTCAGGG + Intronic
1055584762 9:77746968-77746990 TTTGTATTTTTATCAAATAATGG - Intronic
1055670775 9:78603991-78604013 AATGTACAATGATCAAATCAGGG - Intergenic
1055816874 9:80217242-80217264 GGTGTATAATGATCAAATAAGGG - Intergenic
1055984773 9:82046767-82046789 GTTGTTTTATGTACAATTCATGG - Intergenic
1056040113 9:82656887-82656909 ATTGTATAATGATCAAATAAGGG + Intergenic
1056171607 9:83990671-83990693 AGTGTGTAATGATCAAATCAGGG - Intronic
1056296152 9:85195090-85195112 ATTGTGTAATGATCAAATCAGGG - Intergenic
1056644835 9:88401941-88401963 AATGTATAATGATCAAGTCAGGG + Intronic
1056778212 9:89529643-89529665 ATTGTGTAATGATCAAATCAGGG + Intergenic
1056947215 9:91008557-91008579 ATTATGTAATGATCAAATCACGG - Intergenic
1057299195 9:93867043-93867065 GTTGTATAATGATCCAATTAGGG + Intergenic
1057492643 9:95533753-95533775 CATGTATAATGATCAAGTCAGGG - Intergenic
1057590871 9:96372407-96372429 ATGGTTTTATGATCCAATCAAGG - Intronic
1057980432 9:99656217-99656239 AATATATAATGATCAAATCAAGG - Intergenic
1058005581 9:99910612-99910634 AATGTGTAATGATCAAATCAGGG + Intronic
1058136623 9:101315035-101315057 AATGTATAATGATCAAATCTGGG + Intronic
1058241920 9:102573481-102573503 ATTGCATGATGATTAAATCAAGG - Intergenic
1058268638 9:102940639-102940661 ATTGTATAATGATCAAATCAGGG + Intergenic
1058272679 9:102992917-102992939 ATTGTATAATAATCAAACCACGG - Intergenic
1058335470 9:103822980-103823002 ATTGTATTTTTATCAAATCTTGG + Intergenic
1058343611 9:103929770-103929792 AATGTGTAATGATCAAATCAAGG - Intergenic
1058377087 9:104335265-104335287 ATTGTATAATGATCAAAGCAGGG + Intergenic
1059209407 9:112498698-112498720 AACGTATAATGATCAAATCAGGG + Intronic
1059291980 9:113233847-113233869 AATGTATAATGATCAAATCAGGG + Intronic
1059376028 9:113882375-113882397 GTTGTTTTAGGATTAAATGAAGG + Intronic
1059685507 9:116631783-116631805 AATGTATAATTATCAAATCAGGG - Intronic
1059899967 9:118913178-118913200 AATGTATAATGATCAAATCAGGG + Intergenic
1059970275 9:119660263-119660285 GTTGTATCATGATCAAATCAGGG - Intergenic
1060167239 9:121428500-121428522 AGTGTATAATGATCCAATCAGGG - Intergenic
1062757560 9:138310025-138310047 GTTATAGTATGACCACATCAAGG - Intergenic
1203361853 Un_KI270442v1:223171-223193 GTTGTATTATGTTCTTCTCAGGG - Intergenic
1185945514 X:4371398-4371420 ATTGTGTAATGATCAAGTCAGGG + Intergenic
1185965842 X:4602006-4602028 ATTGTGTAATGATCAAATCAGGG + Intergenic
1185969413 X:4645639-4645661 AGTGTATGATGATCGAATCAGGG - Intergenic
1186069250 X:5800289-5800311 AATGTGTAATGATCAAATCAGGG - Intergenic
1186140354 X:6565496-6565518 AATGTGTAATGATCAAATCAGGG - Intergenic
1186238134 X:7535673-7535695 ATTGTATAATGATTAAATCAAGG + Intergenic
1186594109 X:10962056-10962078 AATGTGTAATGATCAAATCAGGG - Intergenic
1186649923 X:11548193-11548215 AATGTGTAATGATCAAATCAAGG + Intronic
1186658939 X:11648210-11648232 ATTGTATAATGATCAAATCAGGG - Intronic
1186751453 X:12625848-12625870 AATGTGTAATGATCAAATCAGGG - Intronic
1186819608 X:13273660-13273682 AATGTATAATGATCAAACCAGGG - Intergenic
1186881048 X:13866553-13866575 ATTGTGTAATGATCAAATCAGGG - Intronic
1186900264 X:14047300-14047322 ATTGTATAATGTTCAAAGCAGGG + Intergenic
1186915597 X:14216561-14216583 CATGTGTCATGATCAAATCAGGG + Intergenic
1186934753 X:14436103-14436125 ACTGTATAATGATCTAATCAAGG + Intergenic
1187054204 X:15726467-15726489 AATTTATAATGATCAAATCAGGG + Intronic
1187145593 X:16634298-16634320 AATGTATAGTGATCAAATCAGGG + Intronic
1187507692 X:19889853-19889875 GTTATATCATGTTCTAATCAGGG + Intergenic
1187750675 X:22460943-22460965 AATGTGTAATGATCAAATCAGGG - Intergenic
1187772210 X:22712469-22712491 ATTGTATAATGATGAAATCAGGG - Intergenic
1188089789 X:25950422-25950444 ATTGTGTAATGATCAAATCAGGG + Intergenic
1188178895 X:27028619-27028641 AATGTGTAATGATCAAATCAGGG - Intergenic
1188220919 X:27540778-27540800 AATGTGTAATGATCAAATCAAGG - Intergenic
1188300365 X:28500588-28500610 GGTGTGTCATGATCAAATCAGGG + Intergenic
1188394083 X:29658748-29658770 AATGTGTAATGATCAAATCAGGG + Intronic
1188396296 X:29687705-29687727 ATTGTGTAATAATCAAATCAGGG - Intronic
1188451816 X:30315400-30315422 AGTGTGTAATGATCAAATCAGGG + Intergenic
1188509985 X:30925453-30925475 ATTGTGTAATGATCAAATCAGGG - Intronic
1188608741 X:32069212-32069234 AATGTGTAATGATCAAATCAGGG - Intronic
1188675581 X:32935524-32935546 ATTGTATTATGGTCATACCATGG - Intronic
1188891633 X:35618489-35618511 GTTGTATAATGATCAAAATCAGG - Intergenic
1189076830 X:37924805-37924827 AATGTGTAATGATCAAATCAGGG + Intronic
1189384998 X:40529981-40530003 AATGTGTAATGATCAAATCAGGG - Intergenic
1189422426 X:40867976-40867998 ATTGTATAATGATCAAGTCAGGG + Intergenic
1189641591 X:43078523-43078545 AATGTATAATGATCAAATCAGGG - Intergenic
1189684258 X:43547585-43547607 TTTGTATTATGAAAAAATTATGG - Intergenic
1189867095 X:45342254-45342276 ACTGTGTAATGATCAAATCAGGG - Intergenic
1189876590 X:45442389-45442411 ATTGTTTAATGATCAAATCAGGG + Intergenic
1190159473 X:48020860-48020882 AATGTGTAATGATCAAATCAGGG + Intronic
1190258656 X:48784342-48784364 ATTGTGTAGTGATCAAATCAAGG - Intergenic
1190371579 X:49747475-49747497 AATGTATAATGATCAAATCAGGG - Intergenic
1190390650 X:49928213-49928235 AATGTGTAATGATCAAATCAGGG - Intronic
1190580255 X:51886338-51886360 CTTGTATAATGATCTCATCAGGG - Intronic
1190580257 X:51886367-51886389 GATGTATAATGATCTCATCAGGG - Intronic
1190892670 X:54584415-54584437 AATGTATAATGATCAAATCAGGG + Intergenic
1190896707 X:54625970-54625992 AATGTATAATGATCAAATCAGGG + Intergenic
1191084976 X:56556327-56556349 CATGTATAATGATCAAATCAGGG - Intergenic
1191600894 X:63004743-63004765 GTTGTATAATAATTAAATAAAGG + Intergenic
1191603407 X:63035007-63035029 CTTATATAATAATCAAATCAGGG - Intergenic
1191661035 X:63650706-63650728 AATGTGTAATGATCAAATCAGGG - Intronic
1191904002 X:66068186-66068208 AATGTATTGTGATCAGATCAGGG + Intergenic
1192187738 X:68964085-68964107 AATGTGTAATGATCAAATCAGGG + Intergenic
1192301133 X:69904138-69904160 AATGTGTAATGATCAAATCAGGG + Intronic
1192409069 X:70916397-70916419 GTTGTGCAATGATCAAATCAGGG + Intergenic
1192614560 X:72606048-72606070 GATGTGTAATGATCAAGTCAGGG + Intronic
1192629441 X:72764705-72764727 AATGTATAATGATCAAGTCAGGG - Intergenic
1192652269 X:72956109-72956131 AATGTATAATGATCAAGTCAGGG + Intergenic
1192769670 X:74174860-74174882 AATATATAATGATCAAATCAGGG - Intergenic
1192799687 X:74453934-74453956 AATGTGTAATGATCAAATCAGGG + Intronic
1192801473 X:74468756-74468778 ATCTTATAATGATCAAATCAAGG + Intronic
1192824413 X:74680200-74680222 ATTGTATAGTGATCGAATCATGG - Intergenic
1193041553 X:77009103-77009125 GATATATAATGATCAAATCAGGG - Intergenic
1193075940 X:77355753-77355775 GCTATGTAATGATCAAATCAGGG + Intergenic
1193134506 X:77955578-77955600 GTTGTACAATGATCAAATCAGGG + Intronic
1193143237 X:78051547-78051569 ATTGCATAATGATCAAATCAGGG + Intergenic
1193283244 X:79681174-79681196 AATATATAATGATCAAATCAGGG + Intergenic
1193436922 X:81485372-81485394 AATGTATAATGATCATATCAGGG - Intergenic
1193711549 X:84886463-84886485 AATGTATACTGATCAAATCAGGG + Intergenic
1194009522 X:88542954-88542976 ATAGTATAATGATCAAATCAGGG - Intergenic
1194321785 X:92458303-92458325 AATGTATAATGATCAAGTCAGGG + Intronic
1194397928 X:93408897-93408919 GATGTGTAATGATCAAATCAAGG - Intergenic
1194473513 X:94329078-94329100 ATTGTGTAATGATCAAATCAGGG - Intergenic
1194686999 X:96932711-96932733 GGTGTGTAATGATCAAATCAGGG + Intronic
1194751577 X:97691001-97691023 AATGTGTAATGATCAAATCAGGG + Intergenic
1194858134 X:98959536-98959558 AATGTGTAATGATCAAATCAGGG - Intergenic
1194872621 X:99152105-99152127 AATGTATTATGATCAAGTCAGGG - Intergenic
1194906332 X:99580757-99580779 AATGTCTAATGATCAAATCAGGG + Intergenic
1194928054 X:99851151-99851173 AATGTGTAATGATCAAATCAGGG - Intergenic
1194959811 X:100222393-100222415 CATGTATAATGATCAAATCTGGG - Intergenic
1194960459 X:100229319-100229341 AATGTATAATGATCAAATCAAGG + Intergenic
1194986866 X:100500067-100500089 AATGTATAATGATTAAATCAGGG - Intergenic
1195036770 X:100977110-100977132 AATGTGTAATGATCAAATCAGGG + Intronic
1195057558 X:101160799-101160821 TTTGTTTAATGATCAAATCATGG - Intronic
1195058985 X:101175726-101175748 ACTGTATAATGATCAAGTCAGGG + Intergenic
1195072802 X:101296782-101296804 AATGTGTAATGATCAAATCAGGG - Intergenic
1195073850 X:101307252-101307274 AATGTGTAATGATCAAATCAGGG - Intergenic
1195267837 X:103200758-103200780 GATGTGTAATGATCAAATCTGGG - Intergenic
1195407359 X:104530111-104530133 GTTGTATAATGATCCAACCAGGG - Intergenic
1195434365 X:104825579-104825601 CTTAAATTATGATCAAATTATGG - Intronic
1195465866 X:105177910-105177932 GCTGTGTAATGATCAAGTCAGGG + Intronic
1195540074 X:106053513-106053535 ATTGCATGGTGATCAAATCAGGG - Intergenic
1195602162 X:106762041-106762063 GTAGTATAATGATCAAATGGGGG + Intronic
1195612219 X:106880739-106880761 ATTGTGCAATGATCAAATCAGGG - Intronic
1195769041 X:108329276-108329298 ATTGTGTAATGATCAAATCCTGG - Intronic
1195791080 X:108587047-108587069 AATGTATAATGATTAAATCAAGG + Intronic
1196042717 X:111222899-111222921 GATATATTATTATCAAATCTTGG - Intronic
1196089591 X:111725665-111725687 AATGTATAATGATCAAATCAAGG - Intronic
1196234703 X:113264930-113264952 AATGTATAATGATCAAATCAGGG + Intergenic
1196237136 X:113295580-113295602 AACGTATAATGATCAAATCAGGG - Intergenic
1196240037 X:113332640-113332662 AATGTGTAATGATCAAATCAGGG + Intergenic
1196289594 X:113923419-113923441 AATATATAATGATCAAATCAGGG + Intergenic
1196306913 X:114113783-114113805 GTTTTATAATGATCAATTCAGGG + Intergenic
1196311455 X:114171624-114171646 AATGTATAATGATCAGATCAAGG + Intergenic
1196318576 X:114260529-114260551 ATTGTGTAATGATCAAATCAGGG + Intergenic
1196374743 X:115020709-115020731 GTTGTGTAATGATCAAATCACGG + Intergenic
1196630384 X:117932110-117932132 ATAGTATAATGAACAAATCAGGG + Intronic
1196642862 X:118083775-118083797 ATTATGTAATGATCAAATCAGGG - Intronic
1196701201 X:118671431-118671453 ATTGTGTAATGATCAAAACAGGG - Intronic
1196722786 X:118870615-118870637 ATTGTGAAATGATCAAATCATGG + Intergenic
1196799264 X:119527876-119527898 AATGTGTAATGATCAAATCAGGG + Intergenic
1196883200 X:120219215-120219237 AATGTATAATGATCAAATAAGGG - Intergenic
1197123208 X:122915038-122915060 AATGTGTAATGATCAAATCATGG + Intergenic
1197140613 X:123113875-123113897 GATGTGTTATAATCACATCATGG - Intergenic
1197369095 X:125603705-125603727 AATGTGTAATGATCAAATCAGGG - Intergenic
1197411868 X:126125633-126125655 ATTGTATAATGATCAAATCAGGG + Intergenic
1197448166 X:126578584-126578606 GTTGTGTAATAATCAAATCAGGG - Intergenic
1197531879 X:127638682-127638704 ATTGTATAATTATCAATTCAGGG - Intergenic
1197587652 X:128369016-128369038 AATGTATAATAATCAAATCAAGG - Intergenic
1197628352 X:128829373-128829395 AATGTAAAATGATCAAATCAGGG + Intergenic
1197689812 X:129486035-129486057 AATGTGTAATGATCAAATCAGGG - Intronic
1197826989 X:130600585-130600607 GTTTTATGATGATCAAATCAGGG + Intergenic
1197857908 X:130937052-130937074 AATGTGTAATGATCAAATCAGGG - Intergenic
1197963491 X:132031264-132031286 GATGTGTAATGATCAAATCAGGG + Intergenic
1197966053 X:132063039-132063061 AATGTATAATGATCACATCAGGG + Intergenic
1197999401 X:132416646-132416668 AATGTGTAATGATCAAATCAGGG - Intronic
1198004820 X:132482282-132482304 AATGTGTAATGATCAAATCAGGG - Intronic
1198142991 X:133824648-133824670 GTTATGTAATGATCAAATCAGGG - Intronic
1198192406 X:134321760-134321782 AATGTGTAATGATCAAATCAGGG + Intergenic
1198475502 X:136993233-136993255 AATGTATAGTGATCAAATCAGGG + Intergenic
1198529673 X:137539217-137539239 AGTGTATAGTGATCAAATCAAGG - Intergenic
1198720038 X:139607320-139607342 AATGTATAATGATCAAATCATGG - Intronic
1198729262 X:139710478-139710500 ACTGTATAATGATGAAATCAGGG + Intergenic
1198742847 X:139859396-139859418 AATGTGTAATGATCAAATCAGGG - Intronic
1198769413 X:140113466-140113488 ATTGTGTAATGATCAAGTCAGGG + Intergenic
1198924512 X:141772581-141772603 AATGTGTAATGATCAAATCATGG - Intergenic
1198953052 X:142094935-142094957 AATGTGTAATGATCAAATCAGGG - Intergenic
1199124299 X:144096586-144096608 AATGTGTAATGATCAAATCAGGG - Intergenic
1199179572 X:144837699-144837721 AATGTGTAATGATCAAATCAGGG + Intergenic
1199254173 X:145699620-145699642 ACTGTGTAATGATCAAATCAGGG + Intergenic
1199259745 X:145758451-145758473 GTTGTGTAATGATCAAATTAGGG - Intergenic
1199386754 X:147232041-147232063 ATTGTGTAATAATCAAATCAGGG - Intergenic
1199756129 X:150866766-150866788 CATGTGTAATGATCAAATCAAGG - Intronic
1199800293 X:151244307-151244329 AATGTATAATGATCTAATCAGGG + Intergenic
1199805390 X:151294834-151294856 AATGTGTAATGATCAAATCAGGG + Intergenic
1199886082 X:152023263-152023285 AATGTGTAATGATCAAATCAGGG + Intergenic
1199904971 X:152216871-152216893 ATTGTGTAATGATCAAATCAGGG - Intronic
1200629956 Y:5571781-5571803 AATGTATAATGATCAAGTCAGGG + Intronic
1201525653 Y:14930801-14930823 AATGTGTAATGATCAAATCAGGG + Intergenic
1201621782 Y:15967135-15967157 GATGTGTAATGATCAAATCAGGG - Intergenic
1201851195 Y:18482688-18482710 GTTATATTATAAACCAATCATGG - Intergenic
1201882124 Y:18837690-18837712 GTTATATTATAAACCAATCATGG + Intergenic
1202591743 Y:26492268-26492290 ATTGCATAATGATCAAATCATGG + Intergenic