ID: 928595187

View in Genome Browser
Species Human (GRCh38)
Location 2:32853333-32853355
Sequence GTTTAAGGAAATTTTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928595185_928595187 -10 Left 928595185 2:32853320-32853342 CCAAGATAGCTCTGTTTAAGGAA No data
Right 928595187 2:32853333-32853355 GTTTAAGGAAATTTTGAGGCTGG No data
928595183_928595187 11 Left 928595183 2:32853299-32853321 CCATTAGATAGTCTAGATTTTCC No data
Right 928595187 2:32853333-32853355 GTTTAAGGAAATTTTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928595187 Original CRISPR GTTTAAGGAAATTTTGAGGC TGG Intergenic
No off target data available for this crispr