ID: 928595751

View in Genome Browser
Species Human (GRCh38)
Location 2:32857430-32857452
Sequence GTGCTCACCCTCTGGGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928595751_928595759 -5 Left 928595751 2:32857430-32857452 CCACCCCCCCAGAGGGTGAGCAC No data
Right 928595759 2:32857448-32857470 AGCACAGTCCTGGCTTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928595751 Original CRISPR GTGCTCACCCTCTGGGGGGG TGG (reversed) Intergenic
No off target data available for this crispr