ID: 928598761

View in Genome Browser
Species Human (GRCh38)
Location 2:32883343-32883365
Sequence CACATGTTCTTAAGAACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928598756_928598761 20 Left 928598756 2:32883300-32883322 CCTTCTTGGAAATGGAATAGTTT No data
Right 928598761 2:32883343-32883365 CACATGTTCTTAAGAACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928598761 Original CRISPR CACATGTTCTTAAGAACAAA GGG Intergenic
No off target data available for this crispr