ID: 928600007

View in Genome Browser
Species Human (GRCh38)
Location 2:32895191-32895213
Sequence CATTATATGGCAAAAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928599998_928600007 29 Left 928599998 2:32895139-32895161 CCCCTCTTTGAGTGTGAGTGTGA No data
Right 928600007 2:32895191-32895213 CATTATATGGCAAAAGTGGAGGG No data
928600000_928600007 27 Left 928600000 2:32895141-32895163 CCTCTTTGAGTGTGAGTGTGACC No data
Right 928600007 2:32895191-32895213 CATTATATGGCAAAAGTGGAGGG No data
928599997_928600007 30 Left 928599997 2:32895138-32895160 CCCCCTCTTTGAGTGTGAGTGTG No data
Right 928600007 2:32895191-32895213 CATTATATGGCAAAAGTGGAGGG No data
928600001_928600007 6 Left 928600001 2:32895162-32895184 CCTATGAATCACACTCCATGATT No data
Right 928600007 2:32895191-32895213 CATTATATGGCAAAAGTGGAGGG No data
928600003_928600007 -9 Left 928600003 2:32895177-32895199 CCATGATTAGGTGACATTATATG No data
Right 928600007 2:32895191-32895213 CATTATATGGCAAAAGTGGAGGG No data
928599999_928600007 28 Left 928599999 2:32895140-32895162 CCCTCTTTGAGTGTGAGTGTGAC No data
Right 928600007 2:32895191-32895213 CATTATATGGCAAAAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928600007 Original CRISPR CATTATATGGCAAAAGTGGA GGG Intergenic
No off target data available for this crispr