ID: 928600185

View in Genome Browser
Species Human (GRCh38)
Location 2:32896902-32896924
Sequence CTGTGCCATCCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928600185_928600193 12 Left 928600185 2:32896902-32896924 CCTTCCACCTTGGGATGGCACAG No data
Right 928600193 2:32896937-32896959 CTCCGGATGCCGGCCCCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 60
928600185_928600189 2 Left 928600185 2:32896902-32896924 CCTTCCACCTTGGGATGGCACAG No data
Right 928600189 2:32896927-32896949 AGAAGCCCCTCTCCGGATGCCGG 0: 1
1: 0
2: 5
3: 103
4: 377
928600185_928600188 -5 Left 928600185 2:32896902-32896924 CCTTCCACCTTGGGATGGCACAG No data
Right 928600188 2:32896920-32896942 CACAGCAAGAAGCCCCTCTCCGG 0: 1
1: 0
2: 13
3: 86
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928600185 Original CRISPR CTGTGCCATCCCAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr