ID: 928600789

View in Genome Browser
Species Human (GRCh38)
Location 2:32901579-32901601
Sequence CAGCACTGTGGTCTGTAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928600789_928600798 20 Left 928600789 2:32901579-32901601 CCAAGTTACAGACCACAGTGCTG No data
Right 928600798 2:32901622-32901644 CCAGCTCAGCATAACTGGCATGG No data
928600789_928600799 21 Left 928600789 2:32901579-32901601 CCAAGTTACAGACCACAGTGCTG No data
Right 928600799 2:32901623-32901645 CAGCTCAGCATAACTGGCATGGG No data
928600789_928600795 15 Left 928600789 2:32901579-32901601 CCAAGTTACAGACCACAGTGCTG No data
Right 928600795 2:32901617-32901639 TTCCTCCAGCTCAGCATAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928600789 Original CRISPR CAGCACTGTGGTCTGTAACT TGG (reversed) Intergenic
No off target data available for this crispr