ID: 928600793

View in Genome Browser
Species Human (GRCh38)
Location 2:32901591-32901613
Sequence CCCTCCACATGCCAGCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928600793_928600799 9 Left 928600793 2:32901591-32901613 CCACAGTGCTGGCATGTGGAGGG No data
Right 928600799 2:32901623-32901645 CAGCTCAGCATAACTGGCATGGG No data
928600793_928600795 3 Left 928600793 2:32901591-32901613 CCACAGTGCTGGCATGTGGAGGG No data
Right 928600795 2:32901617-32901639 TTCCTCCAGCTCAGCATAACTGG No data
928600793_928600798 8 Left 928600793 2:32901591-32901613 CCACAGTGCTGGCATGTGGAGGG No data
Right 928600798 2:32901622-32901644 CCAGCTCAGCATAACTGGCATGG No data
928600793_928600800 20 Left 928600793 2:32901591-32901613 CCACAGTGCTGGCATGTGGAGGG No data
Right 928600800 2:32901634-32901656 AACTGGCATGGGAGAAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928600793 Original CRISPR CCCTCCACATGCCAGCACTG TGG (reversed) Intergenic
No off target data available for this crispr