ID: 928600799

View in Genome Browser
Species Human (GRCh38)
Location 2:32901623-32901645
Sequence CAGCTCAGCATAACTGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928600789_928600799 21 Left 928600789 2:32901579-32901601 CCAAGTTACAGACCACAGTGCTG No data
Right 928600799 2:32901623-32901645 CAGCTCAGCATAACTGGCATGGG No data
928600793_928600799 9 Left 928600793 2:32901591-32901613 CCACAGTGCTGGCATGTGGAGGG No data
Right 928600799 2:32901623-32901645 CAGCTCAGCATAACTGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928600799 Original CRISPR CAGCTCAGCATAACTGGCAT GGG Intergenic
No off target data available for this crispr