ID: 928601548

View in Genome Browser
Species Human (GRCh38)
Location 2:32908653-32908675
Sequence CAAGTTATGGAGAAGGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928601548_928601557 27 Left 928601548 2:32908653-32908675 CCATTCCCCTTCTCCATAACTTG No data
Right 928601557 2:32908703-32908725 CCAATCCACTGGTTGAATGGAGG No data
928601548_928601553 16 Left 928601548 2:32908653-32908675 CCATTCCCCTTCTCCATAACTTG No data
Right 928601553 2:32908692-32908714 TTCACCAGCAGCCAATCCACTGG No data
928601548_928601558 28 Left 928601548 2:32908653-32908675 CCATTCCCCTTCTCCATAACTTG No data
Right 928601558 2:32908704-32908726 CAATCCACTGGTTGAATGGAGGG No data
928601548_928601555 24 Left 928601548 2:32908653-32908675 CCATTCCCCTTCTCCATAACTTG No data
Right 928601555 2:32908700-32908722 CAGCCAATCCACTGGTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928601548 Original CRISPR CAAGTTATGGAGAAGGGGAA TGG (reversed) Intergenic
No off target data available for this crispr