ID: 928601553

View in Genome Browser
Species Human (GRCh38)
Location 2:32908692-32908714
Sequence TTCACCAGCAGCCAATCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928601544_928601553 24 Left 928601544 2:32908645-32908667 CCCCCAAACCATTCCCCTTCTCC No data
Right 928601553 2:32908692-32908714 TTCACCAGCAGCCAATCCACTGG No data
928601549_928601553 11 Left 928601549 2:32908658-32908680 CCCCTTCTCCATAACTTGCTACA No data
Right 928601553 2:32908692-32908714 TTCACCAGCAGCCAATCCACTGG No data
928601545_928601553 23 Left 928601545 2:32908646-32908668 CCCCAAACCATTCCCCTTCTCCA No data
Right 928601553 2:32908692-32908714 TTCACCAGCAGCCAATCCACTGG No data
928601547_928601553 21 Left 928601547 2:32908648-32908670 CCAAACCATTCCCCTTCTCCATA No data
Right 928601553 2:32908692-32908714 TTCACCAGCAGCCAATCCACTGG No data
928601543_928601553 27 Left 928601543 2:32908642-32908664 CCTCCCCCAAACCATTCCCCTTC No data
Right 928601553 2:32908692-32908714 TTCACCAGCAGCCAATCCACTGG No data
928601552_928601553 3 Left 928601552 2:32908666-32908688 CCATAACTTGCTACAGTACTTGC No data
Right 928601553 2:32908692-32908714 TTCACCAGCAGCCAATCCACTGG No data
928601546_928601553 22 Left 928601546 2:32908647-32908669 CCCAAACCATTCCCCTTCTCCAT No data
Right 928601553 2:32908692-32908714 TTCACCAGCAGCCAATCCACTGG No data
928601548_928601553 16 Left 928601548 2:32908653-32908675 CCATTCCCCTTCTCCATAACTTG No data
Right 928601553 2:32908692-32908714 TTCACCAGCAGCCAATCCACTGG No data
928601551_928601553 9 Left 928601551 2:32908660-32908682 CCTTCTCCATAACTTGCTACAGT No data
Right 928601553 2:32908692-32908714 TTCACCAGCAGCCAATCCACTGG No data
928601550_928601553 10 Left 928601550 2:32908659-32908681 CCCTTCTCCATAACTTGCTACAG No data
Right 928601553 2:32908692-32908714 TTCACCAGCAGCCAATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928601553 Original CRISPR TTCACCAGCAGCCAATCCAC TGG Intergenic
No off target data available for this crispr