ID: 928601555

View in Genome Browser
Species Human (GRCh38)
Location 2:32908700-32908722
Sequence CAGCCAATCCACTGGTTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928601547_928601555 29 Left 928601547 2:32908648-32908670 CCAAACCATTCCCCTTCTCCATA No data
Right 928601555 2:32908700-32908722 CAGCCAATCCACTGGTTGAATGG No data
928601549_928601555 19 Left 928601549 2:32908658-32908680 CCCCTTCTCCATAACTTGCTACA No data
Right 928601555 2:32908700-32908722 CAGCCAATCCACTGGTTGAATGG No data
928601548_928601555 24 Left 928601548 2:32908653-32908675 CCATTCCCCTTCTCCATAACTTG No data
Right 928601555 2:32908700-32908722 CAGCCAATCCACTGGTTGAATGG No data
928601550_928601555 18 Left 928601550 2:32908659-32908681 CCCTTCTCCATAACTTGCTACAG No data
Right 928601555 2:32908700-32908722 CAGCCAATCCACTGGTTGAATGG No data
928601551_928601555 17 Left 928601551 2:32908660-32908682 CCTTCTCCATAACTTGCTACAGT No data
Right 928601555 2:32908700-32908722 CAGCCAATCCACTGGTTGAATGG No data
928601546_928601555 30 Left 928601546 2:32908647-32908669 CCCAAACCATTCCCCTTCTCCAT No data
Right 928601555 2:32908700-32908722 CAGCCAATCCACTGGTTGAATGG No data
928601552_928601555 11 Left 928601552 2:32908666-32908688 CCATAACTTGCTACAGTACTTGC No data
Right 928601555 2:32908700-32908722 CAGCCAATCCACTGGTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928601555 Original CRISPR CAGCCAATCCACTGGTTGAA TGG Intergenic
No off target data available for this crispr