ID: 928601558

View in Genome Browser
Species Human (GRCh38)
Location 2:32908704-32908726
Sequence CAATCCACTGGTTGAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928601548_928601558 28 Left 928601548 2:32908653-32908675 CCATTCCCCTTCTCCATAACTTG No data
Right 928601558 2:32908704-32908726 CAATCCACTGGTTGAATGGAGGG No data
928601549_928601558 23 Left 928601549 2:32908658-32908680 CCCCTTCTCCATAACTTGCTACA No data
Right 928601558 2:32908704-32908726 CAATCCACTGGTTGAATGGAGGG No data
928601551_928601558 21 Left 928601551 2:32908660-32908682 CCTTCTCCATAACTTGCTACAGT No data
Right 928601558 2:32908704-32908726 CAATCCACTGGTTGAATGGAGGG No data
928601552_928601558 15 Left 928601552 2:32908666-32908688 CCATAACTTGCTACAGTACTTGC No data
Right 928601558 2:32908704-32908726 CAATCCACTGGTTGAATGGAGGG No data
928601550_928601558 22 Left 928601550 2:32908659-32908681 CCCTTCTCCATAACTTGCTACAG No data
Right 928601558 2:32908704-32908726 CAATCCACTGGTTGAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928601558 Original CRISPR CAATCCACTGGTTGAATGGA GGG Intergenic
No off target data available for this crispr