ID: 928603575

View in Genome Browser
Species Human (GRCh38)
Location 2:32924111-32924133
Sequence CAGGTAGATCATCTGACGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928603572_928603575 -1 Left 928603572 2:32924089-32924111 CCTACACTTTGGGAGGCTGAAGC 0: 263
1: 7855
2: 78645
3: 193131
4: 233854
Right 928603575 2:32924111-32924133 CAGGTAGATCATCTGACGTTGGG No data
928603569_928603575 8 Left 928603569 2:32924080-32924102 CCTCTAATCCCTACACTTTGGGA No data
Right 928603575 2:32924111-32924133 CAGGTAGATCATCTGACGTTGGG No data
928603571_928603575 0 Left 928603571 2:32924088-32924110 CCCTACACTTTGGGAGGCTGAAG No data
Right 928603575 2:32924111-32924133 CAGGTAGATCATCTGACGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928603575 Original CRISPR CAGGTAGATCATCTGACGTT GGG Intergenic
No off target data available for this crispr